Cytosolic Phospholipase A2 Modulates TLR2 Signaling in Synoviocytes

Abstract

Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic synovitis leading to destruction of cartilage and bone. PLA2 enzymes are key players in inflammation regulating the release of unsaturated fatty acids such as arachidonic acid (AA), a precursor of pro-inflammatory eicosanoids. Several lines of evidence point to toll-like receptors (TLRs) as drivers of synovitis and joint destruction in RA. However, few studies have addressed the implication of PLA2 activity downstream TLR activation in the synovium. Here, we aimed to characterize PLA2 enzyme involvement in TLR2-induced signaling in synovial fibroblast-like cells. TLRs1-7 and a range of sPLA2, iPLA2 and cPLA2 enzymes were found to be transcriptionally expressed in cultured synoviocytes. Activation of TLR2/1 and TLR2/6 led to phosphorylation of cPLA2α at Ser505, and induced AA release and PGE2 production; effects that were attenuated by cPLA2α inhibitors. In contrast, sPLA2 inhibitors did not affect AA or PGE2 release. cPLA2α inhibitors furthermore attenuated TLR-induced expression of IL-6, IL-8 and COX2. COX1/2 inhibitors attenuated TLR2/6-induced IL-6 transcription and protein production comparable to cPLA2α inhibition. Moreover, exogenously PGE2 added alone induced IL-6 production and completely rescued IL-6 transcription when added simultaneously with FSL-1 in the presence of a cPLA2α inhibitor. Our results demonstrate for the first time that cPLA2α is involved in TLR2/1- and TLR2/6-induced AA release, PGE2 production and pro-inflammatory cytokine expression in synoviocytes, possibly through COX/PGE2-dependent pathways. These findings expand our understanding of cPLA2α as a modulator of inflammatory molecular mechanisms in chronic diseases such as RA.

Deposition and hydrolysis of serine dipeptide lipids of Bacteroidetes bacteria in human arteries: relationship to atherosclerosis

“…Second, genetically engineered mice deficient in LDL or ApoE receptor function demonstrate increased susceptibility to atherosclerosis that is reversed if mice are simultaneously rendered TLR2 deficient (18,20). Finally, TLR2 engagement is reported to increase PLA2 expression in monocytes (36), macrophages (37), and synoviocytes (38). Though PLA2 enzymes have been implicated in promoting atherogenesis, recent reports indicate that pharmacological inhibition of PLA2 has little value in preventing serious cardiovascular events secondary to atherosclerosis.…”

<p>MicroRNA-146a as a Prognostic Biomarker for Esophageal Squamous Cell Carcinoma</p>

“…Pearson Chi-Square and Spearman ҆ s rho test was conducted to evaluate the association of age, gender, smoking and histological grade variable with COX2 expression in tumor tissue samples. It seems that COX2 expression was 5′-UGAGAACUGAAUUCCAUGGGUU-3ʹ Universal 3ʹ primer (included in the kit) COX2 31 GGGGATCAGGGATGAACTTT TGGCTACAAAAGCTGGGAAG GAPDH 31 CATCAAGAAGGTGGTGAAGCAG TGTAGCCAAATTCGTTGTCATACC Figure 1 MiR-146a expression in cancerous tissue and marginal normal tissue. more increased in age<65 (P-value=0.031).…”

The Association between Functional Polymorphisms of COX-2 and Serum PGE2 Level in ESCC Patients in North of Iran

“…Then, the RT product was used as a template for amplification of specific fragments by specific primers (Table2). (Zhang, Miao, Tan, Ning, Liu, & Hong, 2005;Bhandari et al, 2006;Sommerfelt et al, 2015) The expression of COX-2 was measured relative to the expression of GAPDH gene as the internal control gene in tumor and normal tissues, using the 2 -ΔΔCt formula. (Schmittgen & Livak, 2008) A sequence detection system (ABI Prism 7300, Applied Biosystems) was used to quantitate the levels of COX-2 and GAPDH expression, based on the SYBR-Green method.…”