Deep-sea predator niche segregation revealed by combined cetacean biologging and eDNA analysis of cephalopod prey

Abstract

Fundamental insight on predator-prey dynamics in the deep sea is hampered by a lack of combined data on hunting behavior and prey spectra. Deep-sea niche segregation may evolve when predators target specific prey communities, but this hypothesis remains untested. We combined environmental DNA (eDNA) metabarcoding with biologging to assess cephalopod community composition in the deep-sea foraging habitat of two top predator cetaceans. Risso’s dolphin and Cuvier’s beaked whale selectively targeted distinct epi/meso- and bathypelagic foraging zones, holding eDNA of 39 cephalopod taxa, including 22 known prey. Contrary to expectation, extensive taxonomic overlap in prey spectra between foraging zones indicated that predator niche segregation was not driven by prey community composition alone. Instead, intraspecific prey spectrum differences may drive differentiation for hunting fewer, more calorific, mature cephalopods in deeper waters. The novel combination of methods presented here holds great promise to disclose elusive deep-sea predator-prey systems, aiding in their protection.

An Integrative Assessment Combining Deep-Sea Net Sampling, in situ Observations and Environmental DNA Analysis Identifies Cabo Verde as a Cephalopod Biodiversity Hotspot in the Atlantic Ocean

“…The DNA extraction protocol followed Visser et al (2021). Briefly, DNA was extracted from the filters using the DNeasy Blood and Tissue Kit (Qiagen) with modified volumes.…”

“…A universal cephalopod primer targeting the nuclear 18S rRNA gene (Ceph18S_forward: CGCGGCGCTACATATTAGAC, Ceph18S_reverse: GCACTTAACCGACCGTCGAC, amplicon length = 140 -190 bp, de Jonge et al, 2021) was used. The mitochondrial 16S rRNA locus (Jarman et al, 2006) was amplified as well following Visser et al (2021). However, the positive controls on this sequencing run failed, so this data was excluded from further analysis.…”

“…Lowest cephalopod diversities are found in polar regions (14 species in the Arctic Ocean, 22 species in the Antarctic Ocean) (Rosa et al, 2008). Known Atlantic hotspots near oceanic islands are the Canary Islands (83 cephalopod species, Escánez et al, 2020) and the Azores (83 cephalopod species, Pereira et al, 2016;Visser et al, 2021). Another potential hotspot of cephalopod biodiversity is the Cabo Verde archipelago in the eastern tropical Atlantic, but a comprehensive overview of cephalopod diversity is lacking for this region.…”

“…The first study designed a species-specific eDNA primer and was able to detect the giant squid Architeuthis dux in Japanese waters (Wada et al, 2020). The second study used universal cephalopod primers to reconstruct cephalopod community composition in the foraging zones of deep hunting predators off the Azores, detecting 39 cephalopod taxa from 17 families from depths between 50 and 1600 m (Visser et al, 2021). The latter study showed that not all taxa can be detected with the general 18S primer being used.…”

Addressing Cetacean–Fishery Interactions to Inform a Deep-Sea Ecosystem-Based Management in the Gulf of Taranto (Northern Ionian Sea, Central Mediterranean Sea)

“…However, understanding of cetaceans' trophic role and the quantification of its impacts on the food web is still critical. In fact, dietary information is usually obtained by means of stomach content analysis of stranded individuals or stable isotope analysis [13], and only recently through metabarcoding combined with biologging analysis [14]. In particular, the stomach content analysis is still the most adopted one, even though it brings biases and a certain degree of uncertainty since it only leads to the acquisition of site-specific data [15,16].…”