Delayed angiopoietin‐2 blockade reduces influenza‐induced lung injury and improves survival in mice

Abstract

Influenza remains a major cause of death and disability with limited treatment options. Studies of acute lung injury have identified angiopoietin‐2 (Ang‐2) as a key prognostic marker and a potential mediator of Acute respiratory distress syndrome. However, the role of Ang‐2 in viral pneumonia remains poorly defined. This study characterized the time course of lung Ang‐2 expression in severe influenza pneumonia and tested the therapeutic potential of Ang‐2 inhibition. We inoculated adult mice with influenza A (PR8 strain) and measured angiopoietin‐1 (Ang‐1), Ang‐2, and Tie2 expressions during the evolution of inflammatory lung injury over the first 7 days post‐infection (dpi). We tested a peptide‐antibody inhibitor of Ang‐2, L1‐7, administered at 2, 4, and 6 dpi and measured arterial oxygen saturation, survival, pulmonary edema, inflammatory cytokines, and viral load. Finally, we infected primary human alveolar type II epithelial (AT2) cells grown in air‐liquid interface culture with influenza and measured Ang‐2 RNA expression. Influenza caused severe lung injury between 5 and 7 dpi in association with increased Ang‐2 lung RNA and a dramatic increase in Ang‐2 protein in bronchoalveolar lavage. Inhibition of Ang‐2 improved oxygenation and survival and reduced pulmonary edema and alveolar‐capillary barrier permeability to protein without major effects on inflammation or viral load. Finally, influenza increased the expression of Ang‐2 RNA in human AT2 cells. The increased Ang‐2 levels in the airspaces during severe influenza pneumonia and the improvement in clinically relevant outcomes after Ang‐2 antagonism suggest that the Ang‐1/Ang‐2 Tie‐2 signaling axis is a promising therapeutic target in influenza and potentially other causes of viral pneumonia.

Aerosolized nicotine from e-cigarettes alters gene expression, increases lung protein permeability, and impairs viral clearance in murine influenza infection

“…Influenza stimulates the production of several inflammatory cytokines as part of the host defense responses to the virus ( 46 , 47 ). The H1N1 PR8 strain of influenza used in this study is mouse-adapted ( 48 , 49 ) and known to cause viral pneumonia and acute lung injury in mice ( 22 , 23 ). Compared to controls, mice exposed to the carrier VG/PG or to VG/PG/Nic both had higher levels of pro-inflammatory cytokines in BAL fluid seven days after influenza infection.…”

“…The 300 FFUs of influenza virus used in this study is a relatively moderate inoculum dose, compared to our prior experiments ( 22 , 23 ); this dose causes inflammation and lung injury but allows for recovery without significant mortality. Both the mice that were exposed to the aerosolized carrier VG/PG and those to air had reduced influenza virus FFUs in their lungs at 7 dpi than at 3 dpi and returned to viral loads comparable to that at 1 dpi ( Figure 5 ), suggesting the infection was under control at 7 dpi and recovery had initiated in these mice.…”

“…RNA presence and quality in extracts was tested using a DS-11 Fx+ spectrophotometer (DeNovix), and cDNA was created using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). RT-PCR was performed using a SYBR Green Kit (Bio-Rad) and a LightCycler (Roche) with primers specific for influenza viral nucleoprotein A, VNP, (forward: CAGCCTAATCAGACCAAATG, backward: TACCTGCTTCTCAGTTCAAG) and murine GAPDH (forward: AAGGTCATCCCAGAGCTGAA, backward: CTGCTTCACCACCTTCTTGA), as in our prior work ( 23 ). The mRNA concentration specific for VNP to that of GAPDH was calculated.…”

Modulation of the Host Response as a Therapeutic Strategy in Severe Lung Infections

“…Since Ang1 levels remain relatively stable and Ang2 levels rise during infection, an Ang2 blockade presents an alternative approach to increase the barrier integrity via the Tie2 signalling axis. Indeed, treatment of influenza-infected mice with L1-7, a peptide–antibody inhibitor of Ang2, reduced hypoxia, oedema, bronchoalveolar lavage (BAL) protein and alveolar thickening, and improved survival [ 47 ].…”