Delivery of Yeast Telomerase to a DNA Break Depends on the Recruitment Functions of Cdc13 and Est1

Bianchi, Alessandro; Negrini, Simona; Shore, David

doi:10.1016/j.molcel.2004.09.009

Cited by 119 publications

(177 citation statements)

References 39 publications

Supporting

Mentioning

161

Contrasting

Order By: Relevance

“…4C). Our data agree with prior in vivo studies showing that Est1 and Est2 interact in a tlc1-null background and that human Est1A associates directly with the reverse transcriptase subunit in vitro (5,11). However, the interaction is less efficient in the absence of Tlc1, which suggests that the Tlc1 RNA fosters assembly of the complex, as has been previously suggested (12,13).…”

Section: Est1supporting

confidence: 92%

“…Supporting a requisite Est1-Cdc13 interaction for proper telomerase regulation are reciprocal-charge mutants [e.g., est1-60 (K444E) suppresses cdc13-2 (E252K)] that separately lead to telomere DNA shortening (4). Since Est1-60 can bind telomerase in vivo, it was proposed that the K444E mutation disrupts Cdc13 association (4,5). However, other studies suggest that the Cdc13-2 mutation does not disrupt Est1 interactions since wild-type Est1 interacts with Cdc13 and Cdc13-2 in vivo (6)(7)(8).…”

mentioning

confidence: 99%

See 1 more Smart Citation

The conserved Est1 protein stimulates telomerase DNA extension activity

DeZwaan

Freeman

2009

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

The first telomerase cofactor identified was the budding yeast protein Est1, which is conserved through humans. While it is evident that Est1 is required for telomere DNA maintenance, understanding its mechanistic contributions to telomerase regulation has been limited. In vitro, the primary effect of Est1 is to activate telomerase-mediated DNA extension. Although Est1 displayed specific DNA and RNA binding, neither activity contributed significantly to telomerase stimulation. Rather Est1 mediated telomerase upregulation through direct contacts with the reverse transcriptase subunit. In addition to intrinsic Est1 functions, we found that Est1 cooperatively activated telomerase in conjunction with Cdc13 and that the combinatorial effect was dependent upon a known salt-bridge interaction between Est1 (K444) and Cdc13 (E252). Our studies provide insights into the molecular events used to control the enzymatic activity of the telomerase holoenzyme.telomere biology ͉ telomerase regulation

show abstract

Section: Est1supporting

confidence: 92%

mentioning

confidence: 99%

The conserved Est1 protein stimulates telomerase DNA extension activity

DeZwaan

Freeman

2009

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…Both an aliquot of sonicated cleared extract (input) and the immunoprecipitated material were de-cross-linked in TE (Tris-EDTA) plus 1% SDS for at least 8 h at 65°C. Quantitation of immunoprecipitated DNA was obtained by real-time PCR using SYBR Green detection (Bianchi et al, 2004) on an Applied Biosystems ABI Prism 7700 machine (Foster City, CA). Primers used were RPL2B-5Ј (CAGAGAGGTCGTCCCAGTCT) and RPL2B-3Ј (GCA-GAATCCACCAGGAGTGT) for RPL2B promoter and HL228 (GAATT-GAGAGTTGCCCCAGA) and HL229 (AGAAGGCTGGAACGTTGAAA) for the ACT1 gene.…”

Section: Chromatin Immunoprecipitationmentioning

confidence: 99%

Arsenic Toxicity to Saccharomyces cerevisiae Is a Consequence of Inhibition of the TORC1 Kinase Combined with a Chronic Stress Response

Hosiner

Lempiäinen

Reiter³

et al. 2009

MBoC

Self Cite

View full text Add to dashboard Cite

The conserved Target Of Rapamycin (TOR) growth control signaling pathway is a major regulator of genes required for protein synthesis. The ubiquitous toxic metalloid arsenic, as well as mercury and nickel, are shown here to efficiently inhibit the rapamycin-sensitive TORC1 (TOR complex 1) protein kinase. This rapid inhibition of the TORC1 kinase is demonstrated in vivo by the dephosphorylation and inactivation of its downstream effector, the yeast S6 kinase homolog Sch9. Arsenic, mercury, and nickel cause reduction of transcription of ribosome biogenesis genes, which are under the control of Sfp1, a TORC1-regulated transcriptional activator. We report that arsenic stress deactivates Sfp1 as it becomes dephosphorylated, dissociates from chromatin, and exits the nucleus. Curiously, whereas loss of SFP1 function leads to increased arsenic resistance, absence of TOR1 or SCH9 has the opposite effect suggesting that TORC1 has a role beyond down-regulation of Sfp1. Indeed, we show that arsenic activates the transcription factors Msn2 and Msn4 both of which are targets of TORC1 and protein kinase A (PKA). In contrast to TORC1, PKA activity is not repressed during acute arsenic stress. A normal level of PKA activity might serve to dampen the stress response since hyperactive Msn2 will decrease arsenic tolerance. Thus arsenic toxicity in yeast might be determined by the balance between chronic activation of general stress factors in combination with lowered TORC1 kinase activity. INTRODUCTIONThe transition metal arsenic has a long history of human exploitation as both a poison and a medicine. In more recent times EhrlichЈs discovery of the antisyphilitic drug arsphenamine (also known as salvarsan) by systematic chemical modification of arsenic derivatives marked the beginning of modern pharmaceutical research. Arsenic trioxide (ATO) is used today in cancer treatment (Evens et al., 2004;Lu et al., 2007;Wang and Chen, 2008).Exposure to arsenic evokes a broad spectrum of cellular reactions in Saccharomyces cerevisiae Haugen et al., 2004;Jin, 2008;Thorsen et al., 2007) and in higher eukaryotes (Salnikow and Zhitkovich, 2008). A number of mechanisms exist for detoxification, probably because arsenic has always been widespread in the environment. These involve reduction of influx through the aquaglyceroporin Fps1p Thorsen et al., 2006); sequestration into the vacuole in the form of glutathione conjugates, metallothionein, and other metal/protein complexes; and active extrusion (Ghosh et al., 1999). In yeast, genome-wide analysis of the transcription patterns in response to arsenic revealed a complex network of transcription factors controlling the expression of several hundred genes (Haugen et al., 2004;Wysocki et al., 2004;Thorsen et al., 2007). Mitogen-activated protein kinases mediate protective responses involving AP-1-and AP-1-like transcription factors in higher eukaryotes and in fungi (Cavigelli et al., 1996;Rodriguez-Gabriel and Russell, 2005;Thorsen et al., 2006).The mechanisms by which arsenic might influence signalin...

show abstract

“…These data are consistent with a simple model in which Cdc13 binds to the ssDNA of a processed DSB and recruits Est1 by a direct interaction. 14 …”

Section: Introductionmentioning

confidence: 99%

“…16 Furthermore, Shore and colleagues have demonstrated that Cdc13 and Ku70/ Ku80 cooperate in the recruitment of Est2 to an HO-induced DSB. 14 To test the possibility that Ku70-dependent recruitment of the telomerase machinery may also contribute to peripheral localization of a persistent DSB, we monitored recruitment of Mps3 to a persistent DSB in isogenic wildtype and ku70Δ strains (Fig. 2).…”

Section: Introductionmentioning

confidence: 99%

Opening the DNA repair toolbox: Localization of DNA double strand breaks to the nuclear periphery

Oza¹,

Peterson²

2010

Cell Cycle

View full text Add to dashboard Cite

E fficient repair of DNA double strand breaks is essential for cells to avoid increased mutation rates, genomic instability, and even cell death. Consequently, cells have evolved multiple mechanisms for rapidly repairing these DNA lesions, including error-free homologous recombination as well as error-prone pathways such as nonhomologous end joining. What happens to DSBs that are repaired inefficiently or not at all? Recently, several studies in budding yeast have shown that these more recalcitrant DSBs are localized to the nuclear periphery through interactions between the nuclear envelope protein, Mps3, and proteins associated with DSB chromatin. Why these DSBs are tethered to the nuclear periphery is still not clear, though the current view is that alternative repair pathways may be activated at the periphery in a final attempt to repair the lesion. In this Extra View, we discuss these recent reports, and we show that the Est1 component of the telomerase machinery plays an essential role in anchoring DSB chromatin to the nuclear envelope protein, Mps3.

show abstract

Delivery of Yeast Telomerase to a DNA Break Depends on the Recruitment Functions of Cdc13 and Est1

Cited by 119 publications

References 39 publications

The conserved Est1 protein stimulates telomerase DNA extension activity

The conserved Est1 protein stimulates telomerase DNA extension activity

Arsenic Toxicity to Saccharomyces cerevisiae Is a Consequence of Inhibition of the TORC1 Kinase Combined with a Chronic Stress Response

Opening the DNA repair toolbox: Localization of DNA double strand breaks to the nuclear periphery

Contact Info

Product

Resources

About