Description of a novel Mycobacterium simiae allelic variant isolated from Caribbean AIDS patients by PCR-restriction enzyme analysis and sequencing of hsp 65 gene

Legrand, Eric; Goh, Khye Seng; Sola, Christophe; Rastogi, Nalin

doi:10.1006/mcpr.2000.0325

Cited by 18 publications

(12 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This is the first study with LiPA PCR failing to amplify some (3 of 81) of the strains and a similar defect was found in the GenoType assay (1 of 81 strains). The difference between the results of our study and previously reported LiPA test performance probably reflects the genetic variation observed in my- (10,11,14). Although all strains were not identified at the complex or species level, as planned, no interspecies crossreactivity was found.…”

Section: Pcr Amplificationcontrasting

confidence: 99%

“…To our knowledge, the GenoType test has not been evaluated previously. Since intraspecies variation within mycobacteria isolated from different geographical regions has been reported (10,11,14), we wanted to assess the capability of the two assays to correctly detect and identify mycobacterial isolates obtained from patients living in Finland. Further, the two tests were compared for cost-effectiveness, ease of use, and interpretation of results.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Evaluation of GenoType and LiPA MYCOBACTERIA Assays for Identification of Finnish Mycobacterial Isolates

et al. 2002

View full text Add to dashboard Cite

show abstract

Section: Pcr Amplificationcontrasting

confidence: 99%

mentioning

confidence: 99%

Evaluation of GenoType and LiPA MYCOBACTERIA Assays for Identification of Finnish Mycobacterial Isolates

et al. 2002

View full text Add to dashboard Cite

show abstract

“…Sequencing of the hsp65 gene was performed as described previously (9). Briefly, the 21M13 forward primer TB11 (5Ј-T GTAAAACGACGGCCAGTACCAACGATGGTGTGTCC AT-3Ј) and the M13 reverse primer TB12 (5Ј-CAGGAAACA GCTATGACCCTTGTCGAACCGCATACCCT-3Ј) (underscores indicate forward and reverse primers [21M13 and M13, respectively]) were used to amplify a 441-bp portion of the hsp65 gene (9,13).…”

mentioning

confidence: 99%

“…Briefly, the 21M13 forward primer TB11 (5Ј-T GTAAAACGACGGCCAGTACCAACGATGGTGTGTCC AT-3Ј) and the M13 reverse primer TB12 (5Ј-CAGGAAACA GCTATGACCCTTGTCGAACCGCATACCCT-3Ј) (underscores indicate forward and reverse primers [21M13 and M13, respectively]) were used to amplify a 441-bp portion of the hsp65 gene (9,13). The amplification product (10 l) was first checked by agarose gel electrophoresis, and 40 l was purified with the QIAquick PCR purification kit (Qiagen, Courtaboeuf, France).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Rapid Differentiation of “ Mycobacterium canettii ” from Other Mycobacterium tuberculosis Complex Organisms by PCR-Restriction Analysis of the hsp65 Gene

et al. 2001

View full text Add to dashboard Cite

A total of 102 isolates of the Mycobacterium tuberculosis complex, including available "M. canettii" isolates, were studied by PCR-restriction analysis of a 441-bp fragment of the hsp65 gene. PRA upon HhaI enzyme digestion (GCGC) allowed easy differentiatiation of "M. canettii" from other members of the M. tuberculosis complex (three bands of 260, 105, and 60 bp for "M. canetti," compared to four bands of 185, 105, 75, and 60 bp for other members of the M. tuberculosis complex). Sequencing of the 441-bp hsp65 fragment of "M. canettii" isolates showed the disappearance of an HhaI site at position 235 due to a C-to-T transition that corresponded to position 631 of the homologous hsp65 gene of M. tuberculosis H37Rv. Considering that "M. canettii" may also exist as a stable rough morphotype, we suggest that the true number of "M. canettii" isolates may be underestimated in clinical microbiology laboratories.The Mycobacterium tuberculosis complex includes five recognized members; M. tuberculosis and M. africanum are human pathogens, M. bovis is known to infect a wide range of domestic and wild animals as well as humans, M. bovis BCG is a vaccine strain with attenuated virulence, and M. microti is a pathogen of small rodents. Another member named "M. canettii" was added to this list of M. tuberculosis complex organisms in 1997 (the name is given in quotation marks since it does not yet appear on the approved list of bacterial names) (16). In 1969, Georges Canetti, of the Institut Pasteur, Paris, France, was the first to isolate "M. canettii" in France. It was isolated as a smooth-colony variant of M. tuberculosis from a 20-year-old farmer suffering from pulmonary tuberculosis. The original isolate, isolate HB3177, was reported to be virulent for guinea pigs and was temporarily designated "M. tuberculosis var. canettii (negrei)." In 1969 and 1970, two other "M. tuberculosis var. canettii" strains (strains HB3178 and HB3253) were isolated from a 54-year-old dairy-farm worker who had lived in Madagascar and who was suffering from pulmonary tuberculosis and from the pus of a patient of unknown age in Papeete, French Polynesia, who was suffering from adenitis of the armpit, respectively. These three isolates were found to constitute a homogeneous group of isolates within the M. tuberculosis complex and were deposited in the Culture Collection of the Pasteur Institute-Tuberculosis (CIPT) under the numbers CIPT140010059, CIPT140010060, and CIPT140010061, respectively. Studies of the cell wall glycolipids showed that a single phenolic glycolipid (PGL-Tb1) was produced at high levels by these isolates and may explain the smooth phenotype observed in "M. canettii" strains (8, 10).Recently, two other "M. canettii" strains were isolated (11, 16) and were shown to be similar to the original M. canettii strain; they had in common a single copy of IS1081, two copies of IS6110, identical recA gene sequences, and identical spoligotypes (11,15,16). In the present investigation, we have investigated M. tuberculosis complex organisms by ...

show abstract

An Introduction to Mycobacterial Taxonomy, Structure, Drug Resistance, and Pathogenesis

Rastogi¹

2003

Textbook-Atlas of Intestinal Infections in AIDS

View full text Add to dashboard Cite

Description of a novel Mycobacterium simiae allelic variant isolated from Caribbean AIDS patients by PCR-restriction enzyme analysis and sequencing of hsp 65 gene

Cited by 18 publications

References 28 publications

Evaluation of GenoType and LiPA MYCOBACTERIA Assays for Identification of Finnish Mycobacterial Isolates

Evaluation of GenoType and LiPA MYCOBACTERIA Assays for Identification of Finnish Mycobacterial Isolates

Rapid Differentiation of “ Mycobacterium canettii ” from Other Mycobacterium tuberculosis Complex Organisms by PCR-Restriction Analysis of the hsp65 Gene

An Introduction to Mycobacterial Taxonomy, Structure, Drug Resistance, and Pathogenesis

Contact Info

Product

Resources

About