Detection of Bulky Endogenous Oxidative DNA Lesions Derived from 8,5′‐Cyclo‐2′‐deoxyadenosine by ³²P‐Postlabeling Assay

Abstract

8,5’-Cyclopurine-2’-deoxynucleotides represent a class of oxidative DNA lesions that are specifically repaired by nucleotide excision repair but not by base excision repair or direct enzymatic reversion. 32P-postlabeling assay is an ultrasensitive method that has been extensively used for the detection of carcinogen-DNA adducts in laboratory animal and epidemiological studies. This assay under modified chromatographic conditions is also a suitable and sensitive method for the detection of 8,5'-cyclo-2'-deoxyadenosine (cA). After enzymatic digestion of DNA, and enrichment of the oxidative products from the DNA digest, four dinucleotides containing cA, i.e. Ap-cAp, Cp-cAp, Gp-cAp, and Tp-cAp, are 5’-labeled with 32P-orthophosphate form [γ-32P]ATP mediated by polynucleotide kinase (PNK). The 32P-labeled cA products are separated by two-dimensional thin-layer chromatography (TLC) and quantified by Instant Imager or by a scintillation counter. The assay only requires 1–10 µg of DNA sample and is capable of detecting cA lesions as low as 1 in 1010 normal nucleotides.

5′,8-Cyclopurine Lesions in DNA Damage: Chemical, Analytical, Biological, and Diagnostic Significance

“…Each quantification technique is characterized by its own advantages, counterbalanced by some limitations for applicability to specific fields. The 32 P-postlabeling approach for the measurement of cdA lesions developed by some research groups was important for increasing the detection limit to 1–5 lesions per 10 10 unmodified nucleosides [90,91]. This methodology was then implemented for the identification and measurement of structurally diverse DNA carcinogen adducts [92], 8-oxo-dG in rat tissues [93], and oxidative DNA products, emerging as a suitable approach for detection of bulky lesions [94].…”

“…The levels of cdA in rat samples were significantly elevated in normal newborn samples compared to those in fetuses [90]. 32 P-labeled adducts could be visualized by screen-enhanced autoradiography and quantified by Phosphorimager, Instant Imager, or Scintillation Analyzer [91,95].…”

Role of Human NADPH Quinone Oxidoreductase (NQO1) in Oxygen‐Mediated Cellular Injury and Oxidative DNA Damage in Human Pulmonary Cells

“…Primers for AHR, CYP1A1, and NQO1 were obtained following the method of Shivanna et al in 2011 [32]. Other primers included the following: NME1, tcattgcgatcaaaccagat and caacgtagtgttccttgaga; PCNA, aggcactcaaggacctcatca and gagtccatgctctgcaggttt; ERCC1, ggcgacgtaattcccgacta and agttcttccccaggctctgc; OGG1, gatgttgttgttggaggaa and aagaggt ggctcagaaat; XPC, taaatagcaaatctcctttcc and acacctactacctc ]-ATP mediated by polynucleotide kinase and then separated by two-dimensional thin-layer chromatography per the previously described method [16,[33][34][35][36].…”

“…The labeled nucleotides were chromatographed on polyethyleneimine-impregnated cellulose thin-layer chromatography (TLC) plates and imaged by the InstantImager (Packard Instruments, Merien, Connecticut). Levels of total 8,5-cyclo-20-deoxyadenosine (cA) oxidative DNA adducts as well as the individual dinucleotides adenine cA (AcA), guanine cA (GcA), cytosine (GcA), and thymine cA (TcA) were analyzed as reported previously [25,35]. 32 Plabeled DNA adducts were quantified by InstantImager [35,36].…”

“…Levels of total 8,5-cyclo-20-deoxyadenosine (cA) oxidative DNA adducts as well as the individual dinucleotides adenine cA (AcA), guanine cA (GcA), cytosine (GcA), and thymine cA (TcA) were analyzed as reported previously [25,35]. 32 Plabeled DNA adducts were quantified by InstantImager [35,36]. The oxidative dinucleotide adducts of cells on TLC maps were identified by comparing with those from genomic DNA obtained from endotracheal aspirate of an ARDS patient who was subjected to supplemental oxygen and mechanical ventilation.…”