Detection of Fimbrial and Toxin Genes in Escherichia coli and their Prevalence in Piglets with Diarrhoea. The Application of Colony Hybridization Assay, Polymerase Chain Reaction and Phenotypic Assays

Abstract

Two different genotypic methods, colony hybridization and polymerase chain reaction (PCR), were applied to detect enterotoxin, verotoxin and fimbrial genes in 708 Escherichia coli (E. coli) strains from piglets with diarrhoea. The results were compared with those obtained by phenotypic methods. D N A fragments specific for each of the enterotoxins LT, ST, and ST,, the verotoxins VT,, VT, and VT,,, and for each of the fimbrial genes K88 (F4), K99 (F5), 987P (F6), F41 and F107, respectively, were used as probes in a colony hybridization assay of the E. coli strains. A PCR assay was used as genotypic test for the verotoxin gene. An Enzyme-linked immunosorbent assay (ELISA) using monoclonal antibodies was performed to test for the presence of K88 and K99 fimbriae, and a Vero cell test was performed to test for verotoxin production. Toxin detection kits were applied to detect the E. coli heat-labile enterotoxin (LT) and the heat-stable (ST,) enterotoxin. The correlation between the results obtained by genotypic and phenotypic methods was 97.7-100 %. The prevalence of the different fimbrial and toxin genes in E. coli strains from piglets with neonatal and postweaning diarrhoea were recorded. The verotoxin and the fimbrial F107 genes were found to be more frequent in postweaning E. coli strains than in neonatal E. coli strains. IntroductionEnterotoxigenic Escherichia coli (E. coli) (ETEC) is an important cause of diarrhoea in piglets. The diarrhoea occurs just after birth, in 1-7 day-old piglets, as neonatal diarrhoea. Postweaning diarrhoea occurs just after weaning in 22-49 days old piglets. Recognized virulence factors of the enterotoxigenic E. coli are the fimbrial adhesins K88, K99, 987P and F41 and the enterotoxins ST,, ST, and LT. Due to the lack of suitable methods a complete survey of virulence factors of E. coli strains pathogenic for piglets has not been carried out in Denmark before this study.The plasmid borne genes encoding ST,, STb and LT have been cloned and sequenced 50 OJENIYI, AHRENS and MEYLING (1981), the K99 fimbrial gene by ROOSENDAAL et al. (1984), the F41 fimbrial gene by FIDOCK et al. (1989) and the 987P fimbrial gene by DE GRAFF & KLAASEN (1987). The F107 fimbrial gene has been sequenced by IMBERECHTS et al. (1992). This information made it possible to synthesize oligonucleotides which, after labelling, may be used directly to identify fimbrial or toxin genes in a colony hybridization test, or used as primers for the amplification of a specific region of the toxin gene using the polymerase chain reaction (PCR) technique. These methods are readily applicable to large numbers of strains in contrast t o the classical methods such as agglutination tests (for fimbriae), infant mouse test (for ST, toxin), ligated swine intestine (for STb) and cell culture tests (for LT toxin), all of which are unsuitable for large scale studies.In the present study, specific DNA probes were constructed by the PCR technique and used in colony hybridization assays t o identify fimbrial and toxin genes of E. coli iso...

Frequency of virulence genes in Escherichia coli strains isolated from piglets with diarrhea in the North Parana State, Brazil

“…Several studies in many countries have reported that infection with ETEC carrying the F5, F6 or F41 fimbriae is agerelated, occurring in pigs less than 2 weeks of age (10,17,18). In this study we detected the genes for F5 (30%), F41 (32%) and F6 (25%), similarly these genes were found in 32%, 9.5% and 14.3% in the Minas Gerais State (14).…”

“…In ETEC strains, the fimbrial types F4 (K88) and F18 (F18ab, F18ac) are commonly found in pathogenic E. coli isolated from weaned pigs (4,18,25). There are also other fimbrial structures, such as F5 (K99), F6 (987P), F41, which are associated with porcine ETEC strains, but are more frequently associated with E. coli causing neonatal diarrhea (18,24).…”

“…There are also other fimbrial structures, such as F5 (K99), F6 (987P), F41, which are associated with porcine ETEC strains, but are more frequently associated with E. coli causing neonatal diarrhea (18,24).…”

Prevalence of the Enteroaggregative Escherichia Coli Heat-Stable Enterotoxin 1 Gene and Its Relationship with Fimbrial and Enterotoxin Genes in E. Coli Isolated from Diarrheic Piglets

“…The PCR for fimbriae and enterotoxins was carried out as previously described with slight modification. 4,7,13 Bacterial DNA amplification was performed using 5 l of the supernatant of lysed bacteria, 90 ng of oligonucleotide primers, 0.2 mM each of dATP, dGTP, dCTP, and dTTP, 10 mM Tris HCl (pH 8.8), 1.5 mM MgCl 2 , 50 mM KCl, and 1 unit of Taq polymerase, a all in 50 l of distilled water. The PCR profile used included a denaturing step at 94 C for 1 min, followed by annealing of the primers at T1 for 2 min, with an extension step at 72 C for 1 min.…”

Novel Heat-Stable Enterotoxin (STa) Immunogen Based on Cationic Nanoliposomes: Preparation, Characterization and Immunization

“…The STa primer sequence is (5'TCCGTGAAACAACATGACGG3', 5'ATAACATCCAGCA CAGGCAG3') and K99 primer sequence is (5'TGCGACTA CCAATGCTTCTG3', 5'TATCCACCATTAGACGGAGC3') [16,17]. A standard PCR protocol was adopted according to Salvadori et al [17].…”