Detection of numerous verotoxigenic E. coli serotypes, with multiple antibiotic resistance from cattle faeces and soil

Scott, L.; McGee, P.; Walsh, Ciara; Fanning, Séamus; Sweeney, T.; Blanco, Jorge; Karczmarczyk, Maria; Earley, Bernadette; Leonard, Nola; Sheridan, J.J.

doi:10.1016/j.vetmic.2008.08.008

Cited by 35 publications

(26 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…In Hong Kong, V. parahaemolyticus is the leading cause of food-borne illnesses due to the high rate of seafood consumption among the population (2). Although most cases of infections are self-limiting, fatality can occur among immunocompromised patients or those with debilitating medical conditions such as liver disease or diabetes (3).…”

mentioning

confidence: 99%

CARB-17 Family of β-Lactamases Mediates Intrinsic Resistance to Penicillins in Vibrio parahaemolyticus

Chiou

Chen

2015

Antimicrob Agents Chemother

View full text Add to dashboard Cite

bVibrio parahaemolyticus is commonly resistant to ampicillin, yet the mechanisms underlying this phenomenon are not clear. In this study, a novel class A carbenicillin-hydrolyzing ␤-lactamase (CARB) family of ␤-lactamases, bla CARB-17 , was identified and found to be responsible for the intrinsic penicillin resistance in V. parahaemolyticus. Importantly, bla CARB-17 -like genes were present in all 293 V. parahaemolyticus genome sequences available in GenBank and detectable in all 91 V. parahaemolyticus food isolates, further confirming the intrinsic nature of this gene. Vibrio parahaemolyticus is a major causative agent of gastroenteritis in areas with high seafood consumption rates and has recently become pandemic due to the emergence of the serotype O3:K6 (1). In Hong Kong, V. parahaemolyticus is the leading cause of food-borne illnesses due to the high rate of seafood consumption among the population (2). Although most cases of infections are self-limiting, fatality can occur among immunocompromised patients or those with debilitating medical conditions such as liver disease or diabetes (3). Antibiotics such as ciprofloxacin can be used for the treatment of infections caused by V. parahaemolyticus strains, but the choice of antibiotics should be based on the antimicrobial susceptibilities of the organism. V. parahaemolyticus is commonly considered highly susceptible to virtually all antimicrobials except for penicillins. However, mechanisms mediating the development of penicillin resistance in V. parahaemolyticus are not clear. In this study, we identified a novel carbenicillin-hydrolyzing ␤-lactamase (CARB) from chromosome 2 of V. parahaemolyticus and showed that the product of this gene is responsible for the intrinsic resistance to penicillins in V. parahaemolyticus.A novel potential ␤-lactamase gene, bla V110 , with a length of 852 bp was identified through bioinformatics analysis of the whole-genome sequence of V. parahaemolyticus V110, which was shown to be resistant to ampicillin (4). The full-length novel ␤-lactamase gene was amplified by PCR using primer set F-GCT GAGAGCTCATGAAAAAGTTA, R-CGTAGGATCCTTAACTT TCTTTGTAGTGC and then cloned into Escherichia coli BL21 and tested for the MICs of various ␤-lactams according to CLSI standards (5). E. coli BL21 isolates expressing the novel ␤-lactamase gene exhibited MICs of 256, 512, 256, and 1,024 g/ml toward penicillin G, ampicillin, carbenicillin, and piperacillin, respectively. The Bla V110 enzyme appears to be susceptible to ␤-lactamase inhibitors such as clavulanic acid, sulbactam, and tazobactam (Table 1). To verify whether the penicillin resistance phenotype was attributed to the expression of bla V110 , we further purified a truncated form (60 to 852 bp) of this ␤-lactamase in which the signal peptide was removed and designated mBla V110 . The mBla V110 protein was purified through several steps, including a Ni-nitrilotriacetic acid (NTA) column, thrombin treatment to remove the His tag, and a size exclusion column as previously described (6) (see Fig....

show abstract

mentioning

confidence: 99%

CARB-17 Family of β-Lactamases Mediates Intrinsic Resistance to Penicillins in Vibrio parahaemolyticus

Chiou

Chen

2015

Antimicrob Agents Chemother

View full text Add to dashboard Cite

show abstract

“…It is highly possible that current farm conditions favor O157 and provide a better environment for it (and its larger R 0 value would be, indeed, the consequence of such an environment). The lower transmissibility (smaller R 0 value) of other non-O157 serogroups might be the result of less favorable conditions for them (36,39,40). We further show that transmissibility for serogroup alone for non-O157 was substantially different than transmissibility of EHEC group.…”

Section: Discussionmentioning

confidence: 63%

Basic Reproduction Number and Transmission Dynamics of Common Serogroups of Enterohemorrhagic Escherichia coli

Chen

Sanderson

Lee

et al. 2016

Appl Environ Microbiol

View full text Add to dashboard Cite

Understanding the transmission dynamics of pathogens is essential to determine the epidemiology, ecology, and ways of controlling enterohemorrhagic Escherichia coli (EHEC) in animals and their environments. Our objective was to estimate the epidemiological fitness of common EHEC strains in cattle populations. For that purpose, we developed a Markov chain model to characterize the dynamics of 7 serogroups of enterohemorrhagic Escherichia coli (O26, O45, O103, O111, O121, O145, and O157) in cattle production environments based on a set of cross-sectional data on infection prevalence in 2 years in two U.S. states. The basic reproduction number (R 0 ) was estimated using a Bayesian framework for each serogroup based on two criteria (using serogroup alone [the O-group data] and using O serogroup, Shiga toxin gene[s], and intimin [eae] gene together [the EHEC data]). In addition, correlations between external covariates (e.g., location, ambient temperature, dietary, and probiotic usage) and prevalence/R 0 were quantified. R 0 estimates varied substantially among different EHEC serogroups, with EHEC O157 having an R 0 of >1 (ϳ1.5) and all six other EHEC serogroups having an R 0 of less than 1. Using the O-group data substantially increased R 0 estimates for the O26, O45, and O103 serogroups (R 0 > 1) but not for the others. Different covariates had distinct influences on different serogroups: the coefficients for each covariate were different among serogroups. Our modeling and analysis of this system can be readily expanded to other pathogen systems in order to estimate the pathogen and external factors that influence spread of infectious agents. IMPORTANCEIn this paper we describe a Bayesian modeling framework to estimate basic reproduction numbers of multiple serotypes of Shiga toxin-producing Escherichia coli according to a cross-sectional study. We then coupled a compartmental model to reconstruct the infection dynamics of these serotypes and quantify their risk in the population. We incorporated different sensitivity levels of detecting different serotypes and evaluated their potential influence on the estimation of basic reproduction numbers.

show abstract

“…Different resistance patterns were exhibited by all isolates regardless of their origin; however, the most commonly observed pattern is ampicillin–cephalothin or ampicillin–tetracycline, one isolates from raw beef exhibited ampicillin–cephalothin–tetracycline. It is has been widely established that food production animals, particularly cattle can be a main reservoir of tetracycline–ampicillin–cephalosporin multidrug‐resistant commensal and Shiga toxin‐producing E. coli (Sawant et al, ; Sayah et al, ; Scott et al, ). Multidrug‐resistant was notably observed in commensal E. coli from food animals (cattle, poultry, swine), which might attributed to be independent, simultaneous development of resistance to different or possibly a result of coselection of resistant determinants, that is, exposing of E. coli population in the their ecological niche to one antimicrobial agent may result in resistant to other agents without any prior exposure (Sayah et al, ).…”

Section: Discussionmentioning

confidence: 99%

Diversity of antibiotic‐resistant Shiga toxin‐producing Escherichia coli serogroups in foodstuffs of animal origin in northern India

Khan

Rathore

Abulreesh

et al. 2018

Journal of Food Safety

View full text Add to dashboard Cite

This study aimed to determine the diversity of antibiotic‐resistant Shiga toxin‐producing Escherichia coli (STEC) serogroups in 600 foodstuff samples of animal origin in the northern part of India. Of the 158 (26.33%) E. coli isolates that were detected in food samples the ‘O’ antigen‐based serotyping revealed the abundance of serogroups O60, O86, O154, O73, O50, O8, and O68. Overall, 45 (28.4%) E. coli isolates were potentially verotoxin producers as determined by verotoxin assay and confirmed by polymerase chain reaction (PCR), of which 42.2% of the STEC isolates originated from raw beef. Among 45 STEC isolates, 51.1% harbored vt 1 gene whereas 48.9% of the serogroups carried vt 2 gene. Chi‐squared test revealed significant difference (p = .001) in the prevalence of STEC serogroups in different foodstuffs. STEC serogroups showed higher resistance to nalidixic acid (71.7%) followed by ampicillin (66.6%). Multidrug resistance (i.e., resistance to 3 or more antimicrobial classes) was exhibited by 55.6% of STEC serogroups. Practical applications This investigation demonstrated the diversity of STEC, particularly multidrug‐resistant serogroups in various foodstuffs, which is a matter of serious concern from a public health stand point. Foodstuffs of animal origin available for human consumption in the city of Bareilly, may pose significant health threats due to contamination of various toxigenic and multidrug‐resistant non‐O157 STEC serogroups, and call for public health authorities to enhance surveillance/monitoring programs to prevent the spread of multidrug‐resistant toxigenic non‐O157 STEC serogroups in Indian communities and for better public health protection.

show abstract

Detection of numerous verotoxigenic E. coli serotypes, with multiple antibiotic resistance from cattle faeces and soil

Cited by 35 publications

References 38 publications

CARB-17 Family of β-Lactamases Mediates Intrinsic Resistance to Penicillins in Vibrio parahaemolyticus

CARB-17 Family of β-Lactamases Mediates Intrinsic Resistance to Penicillins in Vibrio parahaemolyticus

Basic Reproduction Number and Transmission Dynamics of Common Serogroups of Enterohemorrhagic Escherichia coli

Diversity of antibiotic‐resistant Shiga toxin‐producing Escherichia coli serogroups in foodstuffs of animal origin in northern India

Contact Info

Product

Resources

About