Detection of the four major human herpesviruses simultaneously in whole blood and cerebrospinal fluid samples by the fluorescence polarization assay

Z, Wu; Chen, Rui; Wang, Xiangling; Ding, Li; Zhao, Jingbo; Guo, Yanhai; Zhang, Ju

doi:10.1016/j.ijid.2010.03.023

Cited by 2 publications

(1 citation statement)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It contained 1 mM Tris (pH 8.0), 2 mM EDTA, 1% SDS, and 2 mg/mL Proteinase K (Fisher BioReagents, Pittsburgh, PA, USA). 5’ thiol‐modified HSV‐1 probe (5’‐caaggctcacgtgcgagagagcctcctc‐3’) was designed to specifically target UL30 gene of HSV‐1, which was then prepared in DNAse/RNAse free water at a concentration of 20 μM. Genomic dsDNAs of HSV‐1 (Strain McIntyre, ATCC VR‐539D, ATCC, Manassas, VA, USA) and HSV‐2 (Strain G, ATCCۚ VR‐734, ATCC) were prepared in ultrapure water at concentration of 36 and 1.3 μg/mL, respectively, as stock sample solution.…”

Section: Methodsmentioning

confidence: 99%

Capacitive DNA sensor for rapid and sensitive detection of whole genome human herpesvirus‐1 dsDNA in serum

et al. 2017

View full text Add to dashboard Cite

This work presents a rapid, highly sensitive, low-cost, and specific capacitive DNA sensor for detection of whole genome human herpesvirus-1 DNA. This sensor is capable of direct DNA detection with a response time of 30 s, and it can be used to test standard buffer or serum samples. The sensing approach for DNA detection is based on alternating current (AC) electrokinetics. By applying an inhomogeneous AC electric field on sensor electrodes, positive dielectrophoresis is induced to accelerate DNA hybridization. The same applied AC signal also directly measures the hybridization of target with the probe on the sensor surface. Experiments are conducted to optimize the AC signal, as well as the buffers for probe immobilization and target DNA hybridization. The assay is highly sensitive and specific, with no response to human herpesvirus-2 DNA at 5 ng/mL and a LOD of 1.0 pg/mL (6.5 copies/μL or 10.7 aM) in standard buffer. When testing the double stranded (ds) DNA spiked in human serum samples, the sensor yields a LOD of 20.0 pg/mL (129.5 copies/μL or 0.21 femtomolar (fM)) in neat serum. In this work, the target is whole genome dsDNA, consequently the test can be performed without the use of enzyme or amplification, which considerably simplifies the sensor operation and is highly suitable for point of care disease diagnosis.

show abstract

Section: Methodsmentioning

confidence: 99%

Capacitive DNA sensor for rapid and sensitive detection of whole genome human herpesvirus‐1 dsDNA in serum

et al. 2017

View full text Add to dashboard Cite

show abstract

Multi-analyte suspension arrays for the detection of common viruses: how viable are these assays in clinical laboratories?

Fathima

Drews

2011

Expert Review of Anti-infective Therapy

View full text Add to dashboard Cite

This article assesses the viability of a recently described multi-analyte suspension array for the detection of herpes simplex viruses-1 and -2, cytomegalovirus, Epstein-Barr virus, human papillomavirus and hepatitis B virus. This methodology was identified by the authors as a means of providing rapid, high-throughput multiplex assays that were easy to use. When paired with PCR assays, multi-analyte suspension arrays have the ability to overcome drawbacks associated with conventional detection methods such as long turnaround time, detection sensitivity and the ability to detect only one pathogen in each round of testing. However, the assays described in this article are still hampered by some key issues including limit of detection, the fact that median fluorescence intensity is not truly a quantitative diagnostic method, and that open molecular diagnostic systems can lead to contamination and/or increased operator-based errors. Although modern pressures on clinical virology laboratories have increased the need to develop a system that can detect pathogens in multiplexed assays, in the future these assays will only become more clinically relevant if they are designed with greater stakeholder input.

show abstract

Detection of the four major human herpesviruses simultaneously in whole blood and cerebrospinal fluid samples by the fluorescence polarization assay

Abstract: The fluorescence polarization assay presented in this study is a reliable, convenient, and cost-effective diagnostic tool that allows the detection of the four major human herpesviruses.

Cited by 2 publications

References 17 publications

Capacitive DNA sensor for rapid and sensitive detection of whole genome human herpesvirus‐1 dsDNA in serum

Capacitive DNA sensor for rapid and sensitive detection of whole genome human herpesvirus‐1 dsDNA in serum

Multi-analyte suspension arrays for the detection of common viruses: how viable are these assays in clinical laboratories?

Contact Info

Product

Resources

About