Detection of Tilapia Lake Virus Using Conventional RT-PCR and SYBR Green RT-qPCR

Abstract

The aim of this method is to facilitate the fast, sensitive and specific detection of Tilapia Lake Virus (TiLV) in tilapia tissues. This protocol can be used as part of surveillance programs, biosecurity measures and in TiLV basic research laboratories. The gold standard of virus diagnostics typically involves virus isolation followed by complementary techniques such as reverse-transcription polymerase chain reaction (RT-PCR) for further verification. This can be cumbersome, time-consuming and typically requires tissue samples heavily infected with virus. The use of RTquantitative (q)PCR in the detection of viruses is advantageous because of its quantitative nature, high sensitivity, specificity, scalability and its rapid time to result. Here, the entire method of PCR based approaches for TiLV detection is described, from tilapia organ sectioning, total ribonucleic acid (RNA) extraction using a guanidium thiocyanate-phenol-chloroform solution, RNA quantification, followed by a two-step PCR protocol entailing, complementary deoxyribonucleic acid (cDNA) synthesis and detection of TiLV by either conventional PCR or quantitative identification via qPCR using SYBR green I dye. Conventional PCR requires post-PCR steps and will simply inform about the presence of the virus. The latter approach will allow for absolute quantification of TiLV down to as little as 2 copies and thus is exceptionally useful for TiLV diagnosis in sub-clinical cases. A detailed description of the two PCR approaches, representative results from two laboratories and a thorough discussion of the critical parameters of both have been included to ensure that researchers and diagnosticians find their most suitable and applicable method of TiLV detection.

Retracted: Tilapia lake virus disease: Phylogenetic analysis reveals that two distinct clades are circulating in Israel simultaneously

“…RNA was extracted using Maxwell ® 16 LEV simplyRNA Tissue Kit (Promega) according to the manufacturer's protocol. SYBR Green RT‐qPCR was performed using PCRBIO 1‐Step Go RT‐PCR Kit (PCR Biosystems Ltd) with TiLV‐specific primers TiLV‐112F (5′‐CTGAGCTAAAGAGGCAATATGGATT‐3′) and TiLV‐112R (5′‐CGTGCGTACTCGTTCAGTATAAGTTCT‐3′) (Nicholson, Rawiwan, & Surachetpong, ).…”

“…In the laboratory, 89 and 39 duplicate brain and liver tissue samples TiLV-112R (5′-CGTGCGTACTCGTTCAGTATAAGTTCT-3′) (Nicholson, Rawiwan, & Surachetpong, 2018).…”

Tilapia lake virus: The story so far

“…A TaqMan‐based RT‐qPCR assay targeting TiLV segment 3 has also been established to detect the virus using TiLV isolates from different geographical locations (Waiyamitra et al., 2018). Although consistent results between conventional RT‐PCR and SYBR green I‐based RT‐qPCR with similar sensitivity and specificity were compared by two independent laboratories for TiLV detection (Nicholson, Rawiwan, & Surachetpong, 2018), it has to be stressed that all RT‐PCR protocols have not been fully validated according to the validation criteria such as analytical characteristics, diagnostic characteristics, reproducibility and implementation of the test recommended by OIE (OIE, 2019). All primer sequences used for the PCR assays are summarized in Table 4.…”

Evidence of potential vertical transmission of tilapia lake virus

“…The quality and quantity of RNA were examined using Nanodrop spectrophotometer ND 2000 (Thermo Scientific). Analysis of TiLV RNA was performed using RT-qPCR protocol as previously described (Nicholson, Rawiwan, & Surachetpong, 2018;Tattiyapong, Sirikanchana, & Surachetpong, 2018). The assays were carried out in the CFX96™ thermocycler (Bio-Rad).…”