Determination of the LOQ in real-time PCR by receiver operating characteristic curve analysis: application to qPCR assays for Fusarium verticillioides and F. proliferatum

Abstract

Real-time PCR (qPCR) is the principal technique for the quantification of pathogen biomass in host tissue, yet no generic methods exist for the determination of the limit of quantification (LOQ) and the limit of detection (LOD) in qPCR. We suggest using the Youden index in the context of the receiver operating characteristic (ROC) curve analysis for this purpose. The LOQ was defined as the amount of target DNA that maximizes the sum of sensitivity and specificity. The LOD was defined as the lowest amount of target DNA that was amplified with a false-negative rate below a given threshold. We applied this concept to qPCR assays for Fusarium verticillioides and Fusarium proliferatum DNA in maize kernels. Spiked matrix and field samples characterized by melting curve analysis of PCR products were used as the source of true positives and true negatives. On the basis of the analysis of sensitivity and specificity of the assays, we estimated the LOQ values as 0.11 pg of DNA for spiked matrix and 0.62 pg of DNA for field samples for F. verticillioides. The LOQ values for F. proliferatum were 0.03 pg for spiked matrix and 0.24 pg for field samples. The mean LOQ values correspond to approximately eight genomes for F. verticillioides and three genomes for F. proliferatum. We demonstrated that the ROC analysis concept, developed for qualitative diagnostics, can be used for the determination of performance parameters of quantitative PCR.

Plasma-Based Degradation of Mycotoxins Produced by Fusarium, Aspergillus and Alternaria Species

“…The spores were suspended in sterile tap water and stored at −60 °C. Rice cultures were prepared as described (Nutz et al [38]). All mycotoxins except fumonisins were extracted from 5 g rice cultures with 40 mL acetonitrile overnight with shaking, while fumonisins were extracted with methanol.…”

Relationship between European Corn Borer injury, Fusarium proliferatum and F. subglutinans infection and moniliformin contamination in maize

“…Quantification of F. verticillioides, F. proliferatum and F. subglutinans using Real Time PCR The primers used for the detection of F. subglutinans were Fsub565 F (TCATTGGTATGTTGTCGCTCATG) and Fsub622A R (GTGATATGTTAGTACGAATAAAGGGAGAAC), designed on the EF1g ene (Nicolaisen et al, 2009;Boutigny et al, 2012). The primers Fp3-F (CGGCCACCAGAGGATGTG) and Fp4-R (CAACACGAATCGCT TCCTGAC), designed by Jurado et al (2006) on the intergenic sequence of the ribosomal RNA gene cluster, for the detection of F. proliferatum and the primers VER1 and VER2, designed by Mulè et al, 2004 on the calmodulin gene, for the detection of F. verticilliodes, were used in Real Time as described by Nutz et al (2011); all were synthesized by PRIMM (PRIMM srl, Milan, Italy).…”

Development of an FgMito assay: A highly sensitive mitochondrial based qPCR assay for quantification of Fusarium graminearum sensu stricto

“…Thus, the limit of quantification (LOQ) of the FgMito assay (0.2 pg) is the equivalent of approximately five haploid cells of F. graminearum s.s. The limit of detection (LOD) corresponds to the lowest amount in a sample that can be detected with a false-negative rate below a given threshold (Nutz et al, 2011). We showed that 0.06 pg of input template could be detected with the FgMito assay, but with a 24% false negative rate only.…”