Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia

Cruz, Patricia; Mehretu, Arthuro; Buttner, Mark P.; Trice, Theresa; Howard, Katherine M.

doi:10.1186/s12903-015-0071-1

Cited by 23 publications

(28 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The highest BMI rate was found in obese female (42%). (Cruz et al, 2015). The analysis of this screening on agarose gel revealed that the prevalence rate of S. noxia among all people was 82.6% (128/155) ( The highest level of the total salivary bacterium S. noxia was recorded in obese people group, followed by the overweight and normal weight people.…”

Section: Resultsmentioning

confidence: 88%

“…are rarely found in microbiological laboratories and probably time consuming. However, rapid polymerase chain reaction (PCR) assay specific for this organism broke this barrier through several studies conducted to detect this bacteria (Cruz et al, 2015).…”

Section: Discussionmentioning

confidence: 99%

“…noxia Forward primer-SNF1: 5'TCTGGGCTACACACGTACTACAATG3', and S. noxia Reverse prime-SNR1, 5'GCCTGCAATCCGAACTGAGA3' with amplicon lengths of 97bp (Cruz et al, 2015;Bui et al, 2017).…”

Section: Polymerase Chain Reaction (Pcr)mentioning

confidence: 99%

See 2 more Smart Citations

Frequency of Selenomonas Noxia in Oral Microbiota of Obese and Normal Weight People in Duhok-Iraq

Qadir

Abdulrahman

2019

SJUOZ

View full text Add to dashboard Cite

Obesity represents one of the major problematic health issues worldwide. Recent evidences suggest that obesity is related with the alteration of the oral microbiome. The aim of this study was to measure the salivary bacterial Selenomonas noxia in Duhok population. A total of 155 saliva samples were collected from individuals (aged between 19-35 years) of both genders (86 females and 69 males). The individuals were divided into three groups (obese, overweight, and normal weight) based on their body mass index. Bacterial genomic DNA was extracted from saliva samples. Molecular detections of Selenomonas noxia were performed by the polymerase chain reaction. Among the 155 participants, 34.1% were obese, 26.4% overweight and 39.3% normal weight individuals. The prevalence rate of oral S. noxia among all people was 82.6%. The highest rate of S. noxia was in obese people (86.8%), followed by overweight (85.4%) and normal weight people (77%). The prevalence of S. noxia in overweight people was statistically significant in compare with the normal weight people (p<0.0001). Moreover, the oral carriage of S. noxia was highest among the overweight females (94.5%) followed by obese females (88.9%). However, no significant difference was found compared to males. The result revealed that it is possible to assume that the expansion of S. noxia in saliva is due to obesity. Moreover, the composition of salivary microbiome may lead to the risk that the overweight group is at risk of future obesity. However, further investigations are required with larger sample and participants with different socioeconomic status in order to address the exact link between obesity and oral bacteria. This could lead to a new and promising therapeutic way for improving human's health.

show abstract

Section: Resultsmentioning

confidence: 88%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Frequency of Selenomonas Noxia in Oral Microbiota of Obese and Normal Weight People in Duhok-Iraq

Qadir

Abdulrahman

2019

SJUOZ

View full text Add to dashboard Cite

show abstract

“…It is well known that this result is much more difficult to obtain in diabetic patients, due both to the decrease in reactivity of neutrophils and leukocytes and the presence of peripheral vasculopathy. A persistence of bacteria within the pocket or on root surfaces seems to undermine healing, since the presence of residual antigenic material on the root surface could result in an increase in the number of neutrophils at the initial healing stage and hence a greater release of proteolitic enzymes, which could in turn delay clot maturation (25)(26)(27)(28)(29)(30). Periodontal diseases have certainly an impact on this situation (20,23,24,.…”

Section: Discussionmentioning

confidence: 99%

Effects of the Application of High-Pressure Oxygen on the Treatment of Periodontal Disease in Diabetic Patients

Sabatini

Ricci²,

Candotto

et al. 2017

ORL

View full text Add to dashboard Cite

SUMMARYPurpose. In this study we wanted to observe the improvement in the healing of periodontal tissues in a group of diabetic patients treated with traditional methods compared to another group treated with the addition of oxygen. The potential of oxygen has long been known in the field of plastic surgery, where it is used to treat burns and skin lesions. Materials and methods. This study consists in a split mouth study which involved 30 patients. We carefully treated them with periodontal therapy using manual and mechanical instrumentation. Then, we applied oxygen in half mouth according to randomization list. Finally we checked up patients after some weeks. Results. Our results highlight that all areas treated with oxygen application healed more rapidly and better than no treated areas. Conclusions. All in all, we have demonstrated that oxygen can improve the outcome of non-surgical periodontal treatment in diabetic subjects.

show abstract

“…The genus is particularly known to be able to digest and degrade fiber [ 35 ]. An example of the genus Selenomonas was first described in 1683 by Antonie Van Leeuwenhoek as a crescent-shaped bacterium from an oral sample [ 36 ]. Later, Selenomonas was isolated from rumen and soil samples [ 37 ].…”

Section: Discussionmentioning

confidence: 99%

Key Microbiota Identification Using Functional Gene Analysis during Pepper (Piper nigrum L.) Peeling

Zhang

et al. 2016

PLoS ONE

View full text Add to dashboard Cite

Pepper pericarp microbiota plays an important role in the pepper peeling process for the production of white pepper. We collected pepper samples at different peeling time points from Hainan Province, China, and used a metagenomic approach to identify changes in the pericarp microbiota based on functional gene analysis. UniFrac distance-based principal coordinates analysis revealed significant changes in the pericarp microbiota structure during peeling, which were attributed to increases in bacteria from the genera Selenomonas and Prevotella. We identified 28 core operational taxonomic units at each time point, mainly belonging to Selenomonas, Prevotella, Megasphaera, Anaerovibrio, and Clostridium genera. The results were confirmed by quantitative polymerase chain reaction. At the functional level, we observed significant increases in microbial features related to acetyl xylan esterase and pectinesterase for pericarp degradation during peeling. These findings offer a new insight into biodegradation for pepper peeling and will promote the development of the white pepper industry.

show abstract

Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia

Cited by 23 publications

References 29 publications

Frequency of Selenomonas Noxia in Oral Microbiota of Obese and Normal Weight People in Duhok-Iraq

Frequency of Selenomonas Noxia in Oral Microbiota of Obese and Normal Weight People in Duhok-Iraq

Effects of the Application of High-Pressure Oxygen on the Treatment of Periodontal Disease in Diabetic Patients

Key Microbiota Identification Using Functional Gene Analysis during Pepper (Piper nigrum L.) Peeling

Contact Info

Product

Resources

About