Development of dual-emission cluster of Ag atoms for genetically modified organisms detection

Alipour, Mohsen; Jalili, Shirin; Shirzad, Hadi; Dezfouli, Ehsan Ansari; Fouani, Mohamad Hassan; Amiri‐Sadeghan, Amir; Bardania, Hassan; Hosseinkhani, Saman

doi:10.1007/s00604-020-04591-2

Cited by 17 publications

(8 citation statements)

References 64 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The solution was incubated for 3 h in dark. After that, 45 μL of a cold solution of NaBH 4 (100 μ m ) was introduced to the solution and vigorously vortexed for 1 min, followed by gently shaking at 4 °C for 1 day [26]. AgNC2@DNAThe oligonucleotide (5′‐GCGCCGCGCCCGCGCCCCCCCTCCTGCAGTG‐3′) was mixed in the total concentration of 500 n m with the methylated target strand (5′‐CACTGCAGGAG(metC)GCGGG(metC)G(metC)GGCGC‐3′) (with equimolar concentration) in Tris‐acetate buffer (pH 6.8, 25 m m , containing 30 m m of Na 2 SO 4 ).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Metal enhanced fluorescence of different metallic nanoclusters deposited on silver dendritic nanostructures

Sabzalipoor

Karimi

Nikkhah

et al. 2022

Micro & Nano Letters

View full text Add to dashboard Cite

Plasmonic nanoclusters (NCs) have been introduced as new fluorescent materials that have low toxicity and do not undergo photo‐bleaching. Several factors including size and type of the NCs, surface chemistry and even solvent affect their luminescence. Despite extensive studies on tuning the fluorescence properties of NCs by manipulation of the above‐mentioned factors, very few researches have been focused on metal enhanced fluorescence (MEF) of them. In this study, the fabrication of silver dendritic nanostructured surfaces (DNSs) with numerous hotspots and unique plasmonic properties were optimized and DNSs were used as the substrates for fluorescence enhancement of NCs. NCs made of gold, silver and copper were synthesized by different stabilizing agents and compared with each other in terms of their MEF characteristics. The results showed that the stabilizing agent, the synthesis method and type of NCs affected their fluorescence enhancement by the DNSs. Copper NCs stabilized by bovine serum albumin (BSA) had the highest rate of fluorescence enhancement, with enhancement factor of 4.8 ± 0.8. Gold NCs synthesized by glutathione (GSH) and bovine serum albumin (BSA) demonstrated 3.9 ± 0.6 and 3.1 ± 0.4 fold fluorescence enhancement, respectively. The possibility of fluorescence enhancement of NCs in the vicinity of plasmonic nano‐structures introduces attractive platforms for sensing purposes.

show abstract

Section: Methodsmentioning

confidence: 99%

“…The solution was incubated for 3 h in dark. After that, 45 μL of a cold solution of NaBH 4 (100 μM) was introduced to the solution and vigorously vortexed for 1 min, followed by gently shaking at 4 • C for 1 day [26].…”

Section: 4mentioning

confidence: 99%

Metal enhanced fluorescence of different metallic nanoclusters deposited on silver dendritic nanostructures

Sabzalipoor

Karimi

Nikkhah

et al. 2022

Micro & Nano Letters

View full text Add to dashboard Cite

show abstract

“…In particular, it has been reported that DNA-AgNCs are illuminated through approaching guanine-rich DNA sequences, indicating the electronic transfer from guanine to the cluster . Furthermore, numerous studies have reported the color switching or lighting methods to identify and quantify certain targets. , Because of its high sensitivity, good specificity, and strong stability, this nucleic acid-based fluorescent signal recognition method has been increasingly applied in various analytical sensors for the detection of metal ions, toxins, bacteria, biomarkers, etc …”

Section: Introductionmentioning

confidence: 99%

“…14 Furthermore, numerous studies have reported the color switching or lighting methods to identify and quantify certain targets. 15,16 Because of its high sensitivity, good specificity, and strong stability, this nucleic acid-based fluorescent signal recognition method has been increasingly applied in various analytical sensors for the detection of metal ions, toxins, bacteria, biomarkers, etc. 17 As a novel nanomaterial, both the fluorescent and antibacterial properties of DNA-AgNCs are worthy of attention.…”

Section: Introductionmentioning

confidence: 99%

Aptamer-Functionalized DNA–Silver Nanocluster Nanofilm for Visual Detection and Elimination of Bacteria

Yang

Zhu

et al. 2021

ACS Appl. Mater. Interfaces

View full text Add to dashboard Cite

As a new type of nanomaterial, DNA-templated silver nanoclusters (DNA-AgNCs) have been widely studied because of their fluorescence and antibacterial properties. In this study, we combined the DNA-AgNCs with aptamers of bacteria to achieve a novel approach for the visual detection and effective elimination of bacteria. The aptamers of Staphylococcus aureus (S. aureus) were linked to G-rich sequences to achieve fluorescence enhancement when approaching the DNA-AgNCs. The capture of aptamers not only realized the visual monitoring of bacteria but also promoted the antibacterial effects. Additionally, a fluorescent nanofilm with excellent selectivity and antibacterial activity in the detection and elimination of S. aureus was developed based on the DNA-AgNCs. These aptamer-functionalized DNA-AgNCs show significant potential for many applications in food packaging and biomedical engineering.

show abstract

“…The designed system included DNA elements related to genetic modification in maize and was able to adopt a three-way junction structure upon hybridization with its target and G-rich sequence. The ratio of green to red fluorescence of the nanocluster exhibited a linear response with the target concentration in the range from 0.01 to 1 µM [11]. Earlier, Feng et al utilized AS1411 aptamer integrated with C-rich sequence (C10) to obtain biostable silver nanocluster for bioimaging specific tumor cells [12].…”

Section: Introductionmentioning

confidence: 99%

Fluorescent AgNCs Formed on Bifunctional DNA Template for Potassium Ion Detection

et al. 2021

View full text Add to dashboard Cite

In this study, we examined properties of silver nanoclusters, which are AgNCs stabilized by DNA oligonucleotide scaffold containing G-quadruplex-forming sequences: human telomeric (Tel22) or thrombin-binding aptamer (TBA). Thus, we obtained two fluorescent probes abbreviated as Tel22C12-AgNCs and TBAC12-AgNCs, which were characterized using absorption, circular dichroism and fluorescence spectroscopy. Both probes emit green and red fluorescence. The presence of silver nanoclusters did not destabilize the formed G-quadruplexes. The structural changes of probes upon binding K+ or Na+ ions cause quenching in their red emission. Green emission was slightly quenched only in the case of Tel22C12-AgNCs; on the contrary, for TBAC12-AgNC’s green emission, we observed an increasing fluorescence signal. Moreover, the Tel22C12-AgNCs system shows not only a higher binding preference for K+ over Na+, but it was able to monitor small changes in K+ concentrations in the buffer mimicking extracellular conditions (high content of Na+ ions). These results suggest that Tel22C12-AgNCs exhibit the potential to monitor transmembrane potassium transport.

show abstract

Development of dual-emission cluster of Ag atoms for genetically modified organisms detection

Cited by 17 publications

References 64 publications

Metal enhanced fluorescence of different metallic nanoclusters deposited on silver dendritic nanostructures

Metal enhanced fluorescence of different metallic nanoclusters deposited on silver dendritic nanostructures

Aptamer-Functionalized DNA–Silver Nanocluster Nanofilm for Visual Detection and Elimination of Bacteria

Fluorescent AgNCs Formed on Bifunctional DNA Template for Potassium Ion Detection

Contact Info

Product

Resources

About