Development of experimental pneumococcal vaccine for mucosal immunization

Gupalova, Tatiana; Leontieva, Galina; Kramskaya, Tatiana; Grabovskaya, K. B.; Kuleshevich, Eugenia; Suvorov, Alexander

doi:10.1371/journal.pone.0218679

Cited by 18 publications

(25 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Conjugated vaccines, however, use the thymus-dependent (T-cell dependent) pathway to establish immunological memory which remains intact 38. Whilst mucosally active vaccines are currently under investigation to induce immunity against S. pneumoniae and N. meningitidis serotype B, their role in the asplenic individual has yet to be evaluated 65,66…”

Section: Solutionsmentioning

confidence: 99%

<p>Post-splenectomy sepsis: preventative strategies, challenges, and solutions</p>

Luu

Spelman

Woolley

2019

IDR

View full text Add to dashboard Cite

Removal of the spleen had already been established as a routine technique to treat splenic trauma and other diseases affecting the spleen before the anatomy, physiology, and function of the spleen were known in the mid-twentieth century. It is now widely accepted that the splenectomized individual is at increased risk for infection, in particular, overwhelming post-splenectomy infection (OPSI). OPSI is a syndrome of fulminant sepsis occurring in splenectomized (asplenic) or hyposplenic individuals that is associated with high mortality and morbidity. Poorly opsonized bacteria such as encapsulated bacteria, in particular, Streptococcus pneumoniae, are often implicated in sepsis. The spleen is a reticuloendothelial organ that facilitates opsonization and phagocytosis of pathogens, in addition to cellular maintenance. Splenectomy is associated with an impairment in immunoglobulin production, antibody-mediated clearance, and phagocytosis, leading to an increased risk of infection and sepsis. Early identification of the at-risk patient, early blood cultures prior to antibiotic administration, urgent blood smears and fast pathogen-detection tests, and sepsis bundles should be utilized in these patients. Prompt management and aggressive treatment can alter the course of disease in the at-risk splenectomized patient. Overwhelming post-splenectomy infection can be prevented through vaccination, chemoprophylaxis, and patient education. This article evaluates post-splenectomy sepsis by summarizing the anatomy and function of the spleen, physiological changes after splenectomy that predispose the splenectomized patient to infection, and current management and prevention strategies.

show abstract

Section: Solutionsmentioning

confidence: 99%

<p>Post-splenectomy sepsis: preventative strategies, challenges, and solutions</p>

Luu

Spelman

Woolley

2019

IDR

View full text Add to dashboard Cite

show abstract

“…The plasmid pEntF-PspF encoding pneumococcal surface protein F (PspF) within the d2 gene from E. faecium L3- encoding pili protein [ 15 ] was hydrolyzed by the NdeI and EcoRI enzymes to remove the PspF gene, and the remaining fragment was used for subsequent cloning of viral epitopes. The digested pJET1.2-(HA2), pJET1.2-(LAH+4M2e) and pEntF-PspF plasmid DNAs were ligated and further transformed into the heterologous system E. coli DH5α using selective medium containing 500 μg/mL of erythromycin.…”

Section: Methodsmentioning

confidence: 99%

“…The Enterococcus faecium L3 culture was transformed by the integrated plasmids using electroporation procedure as described earlier [ 15 ]. The resulting transformants were screened by standard PCR with primers specific to bacterial gene and the viral fragments, followed by amplification of the whole integrated fragments with primers annealing to the bacterial chromosomal gene d2-1 (forward, GCTCTAGAGCCGATGAGAGCAGCTGGTATTG; reverse, CAACAGGATCCAAAGCATCGTTGG).…”

Section: Methodsmentioning

confidence: 99%

A Live Probiotic Vaccine Prototype Based on Conserved Influenza a Virus Antigens Protect Mice against Lethal Influenza Virus Infection

Mezhenskaya¹,

Isakova–Sivak²,

Gupalova³

et al. 2021

Biomedicines

Self Cite

View full text Add to dashboard Cite

Background: Due to the highly variable nature of the antigenic properties of the influenza virus, many efforts have been made to develop broadly reactive influenza vaccines. Various vaccine platforms have been explored to deliver conserved viral antigens to the target cells to induce cross-reactive immune responses. Here, we assessed the feasibility of using Enterococcus faecium L3 as a bacterial vector for oral immunization against influenza virus. Methods: we generated two vaccine prototypes by inserting full-length HA2 (L3-HA2) protein or its long alpha helix (LAH) domain in combination with four M2e tandem repeats (L3-LAH+M2e) into genome of E.faecium L3 probiotic strain. The immunogenicity and protective potential of these oral vaccines were assessed in a lethal challenge model in BALB/c mice. Results: as expected, both vaccine prototypes induced HA stem-targeting antibodies, whereas only L3-LAH+4M2e vaccine induced M2e-specific antibody. The L3-HA2 vaccine partially protected mice against lethal challenge with two H1N1 heterologous viruses, while 100% of animals in the L3-LAH+4M2e vaccine group survived in both challenge experiments, and there was significant protection against weight loss in this group, compared to the L3 vector-immunized control mice. Conclusions: the recombinant enterococcal strain L3-LAH+4M2e can be considered as a promising live probiotic vaccine candidate for influenza prevention and warrants further evaluation in relevant pre-clinical models.

show abstract

“…Obtaining a chimeric protein from E. faecium L3 d2 gene and a fragment of the NA gene DNA fragments corresponding to the NA gene coding 209 AA (123-331) was embedded into recombinant DNA plasmid pentF-pspf, obtained by inserting a total DNA fragment consisting of two separate fragments of the probiotic E. faecium L3 gene and a chimeric pneumococcal protein (PSPF) gene fragment, described in [20]. The oligonucleotide primers used for the reaction are listed in Table 1.…”

Section: Molecular Analysismentioning

confidence: 99%

“…Electroporation of Enterococci was performed as previously described [20]. As a result, 13 transformants were obtained from which 12 transformants were positive in PCR test with EV and FV primers (Figure 2).…”

Section: Molecular Analysismentioning

confidence: 99%

Development of live vaccine based on the Enterococcus faecium L3 vector for prevention influenza infections

Desheva

Leontieva²,

Kramskaya

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

Probiotic microorganisms are currently considered as a promising platform for the development of recombinant vaccines expressing foreign antigens. In this study we generated and evaluated the live mucosal recombinant vaccine by integrating genes encoding influenza virus neuraminidase (NA) of N2 subtype into the DNA of the probiotic strain Enterococcus faecium L3 (L3). We confirmed NA expression in the pili of L3 using immune electron microscopy. Mice were fed with a probiotic vaccine containing the NA gene (L3-NA) or pure L3. Oral administration of L3-NA caused detectable increase of virus-specific serum IgG and local IgA after the third feeding. A the same time, single spleen cell suspensions were stimulated with whole A(H1N1)pdm09 virus followed by flow cytometry. In mice received L3-NA, the content of cytotoxic T-lymphocytes was more pronounced compared to mice receiving pure L3. Immunization with L3-NA increased the survival rate by 34% when the mice were infected using A(H1N1)pdm09 influenza virus after the third feeding. After S. pneumonia post-influenza infection, the L3-NA immunized mice were 50% more protected from lethality in comparison with L3 fed mice. Thus, a live probiotic vaccine candidate based on L3 induced the formation of systemic and local immunity and provide protection against complicated influenza. The approach based on a probiotic vaccine expressing viral epitopes can allow repeated immunization during epidemic season.

show abstract

Development of experimental pneumococcal vaccine for mucosal immunization

Cited by 18 publications

References 34 publications

<p>Post-splenectomy sepsis: preventative strategies, challenges, and solutions</p>

<p>Post-splenectomy sepsis: preventative strategies, challenges, and solutions</p>

A Live Probiotic Vaccine Prototype Based on Conserved Influenza a Virus Antigens Protect Mice against Lethal Influenza Virus Infection

Development of live vaccine based on the Enterococcus faecium L3 vector for prevention influenza infections

Contact Info

Product

Resources

About