Development of methods for detection andAgrobacterium-mediated transformation of the sterile, endophytic fungusMuscodoralbus

Ezra, David; Skovorodnikova, Julia; Kroitor-Keren, Tammy; Denisov, Youlia; Liarzi, Orna

doi:10.1080/09583150903420049

Cited by 16 publications

(8 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The Polymerase Chain Reaction (PCR) mixture comprised 25 ng of extracted genomic DNA, 25 mM MgCl 2 , 2.5 mM dNTP, 10 pmol/µl of each primer, 1.5 U of Taq DNA polymerase in 10X Taq buffer while the PCR amplification conditions used have been previously described by Ezra et al (2009). The ITS rDNA PCR amplicon of approximately 500–600 bp was resolved onto 1.5% agarose gel and further purified by Wizard® SV Gel and PCR clean-up system kit (Promega).…”

Section: Methodsmentioning

confidence: 99%

“…Amplification of the ITS region of #16 AMLWLS was carried out using Muscodor -specific primers, M. albus F (5′ GGGAGGCTACCCTATAGGGGATAC3′) and M. albus R (5′CAGGGGCCGGAACCACTACAGAGG3′) using a My Cycler TM thermal cycler (Bio Rad, Hercules, CA, USA). The Polymerase Chain Reaction (PCR) mixture comprised 25 ng of extracted genomic DNA, 25 mM MgCl 2 , 2.5 mM dNTP, 10 pmol/µl of each primer, 1.5 U of Taq DNA polymerase in 10X Taq buffer while the PCR amplification conditions used have been previously described by Ezra et al (2009) . The ITS rDNA PCR amplicon of approximately 500–600 bp was resolved onto 1.5% agarose gel and further purified by Wizard® SV Gel and PCR clean-up system kit (Promega).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Muscodor kashayumsp. nov. – a new volatile anti-microbial producing endophytic fungus

Meshram

Kapoor

Saxena

2013

Mycology: An International Journal on Fungal Biology

View full text Add to dashboard Cite

Muscodor kashayum (MycoBank no.: MB 803800; GenBank no.: KC481680) is a newly described endophytic fungus of a medicinal plant Aegle marmelos (Bael tree), growing in the tropical conserved rainforest in the Western Ghats of India. Muscodor kashayum possesses distinct morphological, molecular and physiological features from the earlier reported Muscodor species. The fungus forms characteristic rings of the ropy mycelium on potato dextrose agar medium. This sterile fungus is characterised by the presence of a pungent smell which is attributable to a blend of more than 23 volatile organic constituents, predominantly 3-cyclohexen-1-ol,1-(1,5-dimethyl-4-hexenyl)-4-methyl; 1,6-dioxacyclododecane-7,12-dione; 2,6-bis(1,1-dimethylethyl)-4-(1-oxopropyl) phenol; 2,4-di-tert-butylthiophenol and 4-octadecylmorpholine. In the in vitro anti-microbial assay using M. kashayum, growth of 75% of test fungi/yeasts and 72% of the test bacteria were completely inhibited. Therefore, M. Kashayum holds potential for future application to be used as a myco-fumigation agent.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Muscodor kashayumsp. nov. – a new volatile anti-microbial producing endophytic fungus

Meshram

Kapoor

Saxena

2013

Mycology: An International Journal on Fungal Biology

View full text Add to dashboard Cite

show abstract

“…The GFP gene has been successfully inserted into Undifilum oxytropis (Mukherjee et al, 2010), Fusarium equiseti (Macia-Vicente et al, 2009), and Muscodor albus (Ezra et al, 2010) and utilized to study the expression of different proteins and production of mycotoxins. A .…”

Section: Aspergillus Sppmentioning

confidence: 99%

Aflatoxins: A Global Concern for Food Safety, Human Health and Their Management

et al. 2017

View full text Add to dashboard Cite

The aflatoxin producing fungi, Aspergillus spp., are widely spread in nature and have severely contaminated food supplies of humans and animals, resulting in health hazards and even death. Therefore, there is great demand for aflatoxins research to develop suitable methods for their quantification, precise detection and control to ensure the safety of consumers’ health. Here, the chemistry and biosynthesis process of the mycotoxins is discussed in brief along with their occurrence, and the health hazards to humans and livestock. This review focuses on resources, production, detection and control measures of aflatoxins to ensure food and feed safety. The review is informative for health-conscious consumers and research experts in the fields. Furthermore, providing knowledge on aflatoxins toxicity will help in ensure food safety and meet the future demands of the increasing population by decreasing the incidence of outbreaks due to aflatoxins.

show abstract

“…Constitutive and heritable expression of GFP fluorescence in transgenic organisms has provided an ideal system for assessment of organismal viability [49]. In addition, major advantages of the use of reporter genes to study the host-endophyte association include the ability to visually locate fungal mycelia in planta; hence, ideal for monitoring different stages of life cycle, provide fast real-time temporal resolution, facilitate rapid screening and discrimination of different inoculated strains, as well as to distinguish inoculated strains from naturally present plant-associated microorganisms [10,18,50]. Based on all these desirable qualities of fluorescent proteins, sgfp, egfp, and DsRed were selected as reporter genes for the present study.…”

Section: Vector Construction and A Tumefaciens-mediated Transformationmentioning

confidence: 99%

“…However, much less is known about other aspects of the association, such as host colonisation, cross species compatibility, capacity for co-existence of multiple endophytes of the same and different species within the same host, and subsequent vegetative and intergenerational stability. Methods for identification and localisation of endophytes are required in order to study the establishment, development, and progression of host-symbiont interactions, as visible reactions or disease symptoms are generally absent from host plants [10]. Fluorescent proteins such as GFP and DsRed are extremely useful markers in living cells and organisms [11].…”

Section: Introductionmentioning

confidence: 99%

Generation of Epichloë Strains Expressing Fluorescent Proteins Suitable for Studying Host-Endophyte Interactions and Characterisation of a T-DNA Integration Event

et al. 2019

View full text Add to dashboard Cite

Methods for the identification and localisation of endophytic fungi are required to study the establishment, development, and progression of host-symbiont interactions, as visible reactions or disease symptoms are generally absent from host plants. Fluorescent proteins have proved valuable as reporter gene products, allowing non-invasive detection in living cells. This study reports the introduction of genes for two fluorescent proteins, green fluorescent protein (GFP) and red fluorescent protein, DsRed, into the genomes of two distinct perennial ryegrass (Lolium perenne L.)-associated Epichloë endophyte strains using A. tumefaciens-mediated transformation. Comprehensive characterisation of reporter gene-containing endophyte strains was performed using molecular genetic, phenotypic, and bioinformatic tools. A combination of long read and short read sequencing of a selected transformant identified a single complex T-DNA insert of 35,530 bp containing multiple T-DNAs linked together. This approach allowed for comprehensive characterisation of T-DNA integration to single-base resolution, while revealing the unanticipated nature of T-DNA integration in the transformant analysed. These reporter gene endophyte strains were able to establish and maintain stable symbiotum with the host. In addition, the same endophyte strain labelled with two different fluorescent proteins were able to cohabit the same plant. This knowledge can be used to provide the basis to develop strategies to gain new insights into the host-endophyte interaction through independent and simultaneous monitoring in planta throughout its life cycle in greater detail.

show abstract

Development of methods for detection andAgrobacterium-mediated transformation of the sterile, endophytic fungusMuscodoralbus

Cited by 16 publications

References 37 publications

Muscodor kashayumsp. nov. – a new volatile anti-microbial producing endophytic fungus

Muscodor kashayumsp. nov. – a new volatile anti-microbial producing endophytic fungus

Aflatoxins: A Global Concern for Food Safety, Human Health and Their Management

Generation of Epichloë Strains Expressing Fluorescent Proteins Suitable for Studying Host-Endophyte Interactions and Characterisation of a T-DNA Integration Event

Contact Info

Product

Resources

About