Different pathways mediate virus inducibility of the human IFN-α1 and IFN-β genes

MacDonald, Nicholas J.; Kuhl, Dietmar; Maguire, Deborah; Näf, Dieter; Gallant, Peter; Goswamy, Apurva; Hug, Hubert; Büeler, Hansreudi; Chaturvedi, Madan M.; Fuente, José de la; Ruffner, Heinz; Meyer, François; Weissmann, Charles

doi:10.1016/0092-8674(90)90091-r

Cited by 158 publications

(127 citation statements)

References 46 publications

Supporting

Mentioning

121

Contrasting

Unclassified

Order By: Relevance

“…The mutation -102G decreased the affinity of Oct-i but actually resulted in a 3-fold increase in expression after virus induction. The base change in this mutant generates the sequence AAAATGGAAATG, which is virtually identical to the "TG" regulatory sequence GAAATGGAAATG (27). Whether the creation of this sequence is responsible for the observed increase in expression remains to be determined.…”

Section: Resultsmentioning

confidence: 99%

An ATF/CREB binding site is required for virus induction of the human interferon beta gene [corrected]

Maniatis

1992

Proc. Natl. Acad. Sci. U.S.A.

105

View full text Add to dashboard Cite

We report the characterization of a distinct regulatory element of the human interferon (3 (HuIFN-(3) gene promoter, which we designate PRDIV (positive regulatory domain IV). In previous studies, sequences between -104 and -91 base pairs upstream from the start site of transcription were shown to be required for maximal levels of virus induction in mouse L929 cells. We have localized the essential sequence in this region extending from -99 to at least -91, and we show that this sequence is a binding site for a protein of the activating transcription factor/cAMP response element binding protein (ATF/CREB) family of transcription factors. Mutations in PRDIV that decrease the affinity of one member of this family (ATF-2/CRE-BP1) decrease the level of virus induction in vivo.

show abstract

Section: Resultsmentioning

confidence: 99%

An ATF/CREB binding site is required for virus induction of the human interferon beta gene [corrected]

Maniatis

1992

Proc. Natl. Acad. Sci. U.S.A.

105

View full text Add to dashboard Cite

show abstract

“…and HMG-I(Y) (MacDonald et al 1990;Sen & Ranshoff 1993;Taniguchi et al 1995;Thanos & Maniatis 1995).…”

Section: Introductionmentioning

confidence: 99%

Regulation of IFN‐α/β genes: evidence for a dual function of the transcription factor complex ISGF3 in the production and action of IFN‐α/β

et al. 1996

View full text Add to dashboard Cite

“…The concentrations of the oligodeoxynucleotides were determined by their absorbance at 260 nM and annealing and labelling was as described previously [7]. The following were used, double stranded, as labelled probes or competitor oligodeoxynucleotides : the 'core' 14-nucleotide ISRE are printed in bold face and mutant base changes are underlined: 9-27 wild-type, -185 to 147 [5] [29], GAAATGGAAATGGAAATGGAAATG ; nonsense (N) GATCCGAATTCGAGCTCATCCGAATTC-GAGC AAGCTTGCATGCG.…”

Section: Oligodeoxynucleotidesmentioning

confidence: 99%

The interferon‐stimulable response elements of two human genes detect overlapping sets of transcription factors

Parrington¹,

Rogers²,

Gewert

et al. 1993

European Journal of Biochemistry

View full text Add to dashboard Cite

We have previously reported three types of DNA-protein complexes, formed specifically with the interferon-stimulable response elements (ISRE) in the 5' flanking DNA of the interferoninducible 6-16 and 9-27 genes, a type-I interferon-inducible early complex involving factor E (ISGF3), M and G complexes induced more slowly in response to type-I and type-II interferons, respectively and Cl/C2, a constitutive complex(s). Similar complexes have been reported by others. The operationally defined band-shift complexes M, G and C1/C2 are shown here to be heterogeneous and to differ in their factor content, depending on the ISRE probe. With a 9-27 ISRE probe the M, G and CUC2 complexes all contain the y subunit of ISGF3, which is present constitutively but is induced in response to IFN-a (to yield M) or IFN-y (to yield G). In contrast, a 6-16 ISRE probe forms band-shift complexes with IFN-a-inducible and IFN-y-inducible IRFl and IRF2. With a 6-16 ISRE probe, therefore, M and G each correspond to two complexes which co-migrate in band-shift assays, one corresponding to IRFl, the other to IRF2. With this probe, the constitutive complex C1/C2 corresponds predominantly to IRF2. Consistent with this, IRFl and IRF2 have lower affinity for the 9-27 ISRE than the 6-16 ISRE, whereas the reverse is true for E (ISGF3) and its y subunit. Relatively small differences in affinity appear sufficient to determine whether or not a band-shift complex is detected. In the case of IRFl and IRF2, the different affinities for the 6-16 and 9-27 probes are dominated by a dinucleotide sequence in the centre of the 1Cnucleotide 'core' ISRE. In contrast, preferential binding of E (ISGF3) by the 39-nucleotide 9-27 ISRE-containing sequence, although ISRE dependent, appears to be mediated by sequences 3' of the 'core' ISRE. Accordingly, these complexes can be simultaneously assayed using a hybrid probe consisting of the 5' flanking region and 'core' ISRE sequences from the 6-16 gene and sequences immediately 3' of the 'core' 9-27 ISRE sequence. No evidence was obtained for a modulatory role in factor binding for a pseudo-ISRE sequence close to ISRE in the 9-27 gene.The precise roles of IRFl and IRF2 in the induction of IFN-p and the control of interferoninducible gene expression remain to be established. Results from the analysis of the expression of IRFl and IRF2 in wild-woe and mutant cells argue against a dominant negative role for unmodified IRF2.

show abstract

Different pathways mediate virus inducibility of the human IFN-α1 and IFN-β genes

Cited by 158 publications

References 46 publications

An ATF/CREB binding site is required for virus induction of the human interferon beta gene [corrected]

An ATF/CREB binding site is required for virus induction of the human interferon beta gene [corrected]

Regulation of IFN‐α/β genes: evidence for a dual function of the transcription factor complex ISGF3 in the production and action of IFN‐α/β

The interferon‐stimulable response elements of two human genes detect overlapping sets of transcription factors

Contact Info

Product

Resources

About