Differential expression of cytokine genes and iNOS induced by nonviable nontypeable Haemophilus influenzae or its LOS mutants during acute otitis media in the rat

Abstract

SummaryObjective-We have previously demonstrated that the disruptions of nontypeable Haemophilus influenzae (NTHi) lipooligosaccharide (LOS) htrB and rfaD genes may play a role in the pathogenesis of otitis media (OM). The purpose of this study was to determine whether NTHi LOS gene disruptions influence the induction of gene expression for proinflammatory mediators in vivo using the rat model of acute OM.Methods-At 3, 6, 12, 24, 48 and 72 h after transbullar inoculation with nonviable NTHi, expression of genes for the cytokines and chemolines; tumor necrosis factor alpha (TNF-α), interleukin -l β (IL-1β), and IL-6, IL-1α, IL-8, IL-10, and inducible nitric oxide synthase (iNOS) were quantitated by real-time PCR. Enzyme-linked immunosorbent assay was performed to confirm the gene expression data as determined by real-time PCR. The middle ear inflammatory responses were also evaluated. Results-TheNTHi 2019 parent and its isogenic LOS htrB (B29) and rfaD (DK-1) mutant strains induced a significant up-regulation in gene expression for the cytokines examined compared to the sham-inoculated controls at 3, 6 and 12 h post inoculation (P < 0.05 in all cases). However, the NTHi 2019 cohort demonstrated a significant increase in gene expression for TNFα (up to 6 h), IL-1α and IL-8 (up to 24 h), IL-1β and IL-6 (up to 48 h), and IL-10 and iNOS (up to 72 h) relative to the animals inoculated with NTHi B29 (P < 0.05, in all cases), Moreover, the concentrations of inflammatory cells in the middle ear lavage fluid samples from the NTHi 2019 cohort were 2.8-5.3 fold higher than those of the B29 cohort. There were no significant differences in mRNA expression of the cytokines between the NTHi 2019 and the DK-1-treated groups.Conclusions-Data from this study indicate that the disruption of the NTHi htrB gene may impact the temporal mRNA expression of inflammatory mediators and inflammation within the middle ear.

Development of a non-invasive murine infection model for acute otitis media

“…Along with various other functions, IL-1b contributes to permanent pathological changes in the middle ear, mucosal damage, bone erosion, fibrosis and hearing loss. Higher concentrations of IL-1b were observed in purulent, acute, culture-positive effusions (Maeda et al, 2004;Skotnicka & Hassmann, 2008;Tong et al, 2008). Our results indicate a peak TNF-a and IL-1b response in the middle ear cavity at 96 h post-inoculation, whereas the maximum histopathological changes were shown at 144 h post-inoculation.…”

“…Only very few studies have investigated the role of virulence factors in OM models (Chen et al, 2007;Tong et al, 2004Tong et al, , 2008. Chen et al (2007) very nicely demonstrated the first extensive search for genetic requirements for pneumococcal OM by using signature-tagged mutagenesis in a chinchilla OM model and a murine colonization model.…”

Anti-Inflammatory Effect of Recreational Exercise in TNBS-Induced Colitis in Rats: Role of NOS/HO/MPO System

“…cDNA levels were determined by QPCR using StepOne Plus Real-Time PCR System (Life Technologies). Reactions were performed with Power SybrGreen Master Mix (Life Technologies) with the following primer sets:TNF- α sense: GCTCCCTCTCATCAGTTCCA,TNF- α antisense: GGCTTGTCACTCGAGTTTTGA;CXCL1 sense: CATTAATATTTAACGATGTGGATGCGTTTCA,CXCL1 antisense: GCCTACCATCTTTAAACTGCACAAT [25];IL-1 β sense: CAGGAAGGCAGTGTCACTCA,IL-1 β antisense: AGACAGCACGAGGCATTTTT;IL-10 sense: CCTGCTCCTACTGGCTGGAG,IL-10 antisense: TTGTTCAGCTGGTCCTTCTT.To avoid false-positive results due to amplification of contaminating genomic DNA in the cDNA preparation, we used primers spanning exon-exon junctions. All measurements were performed in duplicates with at least four biological replicates.…”

Otitis Media: State of the art concepts and treatment

“…In one of the studies, IL-1β was shown to be induced early (6 h post infection), whereas IL-6, IL-8, and TNF-α appeared later [104]. In rats, SP or nonviable NTHi were potent to induce all the panel of cytokines described before from 6 h to 7 days post infection [105,106]. Different time-dependent expression profiles of pro-inflammatory cytokines are observed but seem to point TNF-α and IL-1β as early cytokines in the response to bacterial challenge, and they are sustained during the disease process.…”