Differential expression of fos and jun family members in the developing chicken gastrointestinal tract

Developmental patterning in chondrocytic cultures by morphogenic gradients: BMP induces expression of Indian hedgehog and Noggin

“…Since pIR-2 contains IRES derived from EMCV just before the exogenous gene, the high-level expression of Noggin protein would be expected, as reported previously (Murakami et al 1997). A palindromic linker (CAGGTTCCAGATCTGGAACCTGGGCC) was inserted into the unique ApaI site of pBS-Ihh (Matsumoto et al 1998) to introduce a BglII site (underlined) 5 0 upstream of the start codon of Ihh. The 1.6 kb BglII-BamHI fragment was isolated from the resultant construct and subcloned into the BglII site of pDS3 to generate pDS3-Ihh.…”

“…The probes for chicken type II collagen, chicken Ihh, chicken Patched, chicken PTHrP and chicken BMP-2 were reported previously (Koyama et al 1996;Marigo et al 1996;Vortkamp et al 1996;Yokouchi et al 1996;Matsumoto et al 1998). The chicken Noggin probe (Tonegawa & Takahashi 1998) was produced from the sequence described by Connolly et al (1997).…”

“…In situ hybridization was performed using digoxigenin-labelled probes on tissue sections or cultured cells as described previously (Matsumoto et al 1998). The probes for chicken type II collagen, chicken Ihh, chicken Patched, chicken PTHrP and chicken BMP-2 were reported previously (Koyama et al 1996;Marigo et al 1996;Vortkamp et al 1996;Yokouchi et al 1996;Matsumoto et al 1998).…”

Kinetics of v-src-induced epithelial–mesenchymal transition in developing glandular stomach

“…In the uninfected cultures, E-cadherin (L-CAM) mRNA was detected in both luminal and glandular epithelial cells (Figure 3d), whereas only luminal epithelial cells expressed Shh mRNA (Figure 3f) (Matsumoto et al, 1998). In RSV-infected cultures, v-srcexpressing cells did not express Shh or E-cadherin (Figure 3c, e).…”

“…In situ hybridization was performed as described previously (Matsumoto et al, 1998). Digoxigeninlabeled antisense RNA probes for in situ hybridization were prepared from cDNA clones of chicken v-src (pRSV-v-Src), Shh (pBSK-Shh, Sukegawa et al, 2000), type I collagen (chicken type I collagen a2) (pBSK-PG45), env of RSV(A) (DS1, Matsumoto et al, 1998), E-cadherin (pBSK-ECAD), ECPg (Tabata and Yasugi, 1998) and cSP . As control experiments, we also synthesized the corresponding sense probes, and confirmed that they did not detect artefactual signals when hybridized to sections of the organ cultures.…”