Differential Gene Expression in Response to Salinity and Temperature in a Haloarcula Strain from Great Salt Lake, Utah

Abstract

Haloarchaea that inhabit Great Salt Lake (GSL), a thalassohaline terminal lake, must respond to the fluctuating climate conditions of the elevated desert of Utah. We investigated how shifting environmental factors, specifically salinity and temperature, affected gene expression in the GSL haloarchaea, NA6-27, which we isolated from the hypersaline north arm of the lake. Combined data from cultivation, microscopy, lipid analysis, antibiotic sensitivity, and 16S rRNA gene alignment, suggest that NA6-27 is a member of the Haloarcula genus. Our prior study demonstrated that archaea in the Haloarcula genus were stable in the GSL microbial community over seasons and years. In this study, RNA arbitrarily primed PCR (RAP-PCR) was used to determine the transcriptional responses of NA6-27 grown under suboptimal salinity and temperature conditions. We observed alteration of the expression of genes related to general stress responses, such as transcription, translation, replication, signal transduction, and energy metabolism. Of the ten genes that were expressed differentially under stress, eight of these genes responded in both conditions, highlighting this general response. We also noted gene regulation specific to salinity and temperature conditions, such as osmoregulation and transport. Taken together, these data indicate that the GSL Haloarcula strain, NA6-27, demonstrates both general and specific responses to salinity and/or temperature stress, and suggest a mechanistic model for homeostasis that may explain the stable presence of this genus in the community as environmental conditions shift.

Geographical Isolation, Buried Depth, and Physicochemical Traits Drive the Variation of Species Diversity and Prokaryotic Community in Three Typical Hypersaline Environments

“…Obviously, the deeper stratums were formed earlier than the upper stratums. The microbial community varied from different stratums with different geological history and environmental parameters, which was similar to the pattern that the microbial community shifted along with the salinity [11,12].…”

“…Salt lakes have the highest fluidity, followed by solar salterns and salt mines. Microbial diversity in salt lakes fluctuates drastically during different seasons [11]. Ion composition and salt concentration have been proposed to be the main factors driving the microbial community structure in different salt lakes of the Tibetan Plateau [12].…”

The Biogeography of Great Salt Lake Halophilic Archaea: Testing the Hypothesis of Avian Mechanical Carriers

“…strain Ha25 grew and produced protein over a range of temperature (30-55 • C) and over a pH range (6.0-8.0) [128]. A Haloarcula strain from Great Salt Lake, which was studied under temperature and salinity stress outside of optimal ranges, adjusted to changing environmental changes by gene regulation, which may provide some insight into the mechanisms of its flexibility with environmental conditions [45]. Under space exposure conditions, in which the temperature ranged from −24.6 to +49.5 • C, Halorubrum chaoviator survived and grew vegetatively when it was returned to the laboratory on Earth [23].…”

“…To amplify a partial sequence of the archaeal 16SrRNA gene, we used the Taq PCR kit (New England Biolabs, Ipswich, Mass) and the halophilic archaeal primers: 1HK (5 ATTCCGGTTGATCCTGCCGG 3 ) [69][70][71][72] and H589R (5 AGCTACGGACGCTTTAGGC 3 ) [45]. Initial denaturation was at 94 • C for 5 min followed by 45 cycles of denaturation (94 • C for 30 s), annealing (58 • C for 60 s), and elongation (72 • C for 60 s).…”

“…In addition, they survive the fluctuation of temperature and salinity in GSL [45], desiccation inside halite crystals [28], and even desiccation in brine shrimp cysts [46]. A GSL Haloarcula strain was shown to adjust gene expression in response to stress [45], and a GSL Halorubrum strain was shown to be highly resistant to desiccation and UV light [28]. These observations suggest mechanisms that assist survival over time under sub-optimal growth conditions in the environment of GSL.…”