Differentiation of seven Eimeria species by random amplified polymorphic DNA

MacPherson, James M.; Gajadhar, Alvin A.

doi:10.1016/0304-4017(93)90080-7

Cited by 45 publications

(23 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…have also been described, for example characterization of the electrophoretic variation of enzymes (Shirley, 1975;Shirley et ai, 1989) and techniques that define variations in genomic DNA (MacPherson & Gajadhar, 1993;Procunier et al, 1993;Shirley, 1994;Shirley & Bumstead, 1994).…”

Section: Introductionmentioning

confidence: 99%

Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic.Eimeriaspecies of the chicken

et al. 1998

View full text Add to dashboard Cite

We describe a polymerase chain reaction (PCR)-based assay for the detection, identification and differentiation of pathogenic species of Eimeria in poultry. The internal transcribed spacer 1 (ITS1) regions of ribosomal DNA (rDNA) from Eimeria acervulina, E. brunetti, E. necatrix and E. tenella were sequenced and regions of unique sequences identified. Four pairs of oligonucleotide primers, each designed to amplify the ITS1 region of a single Eimeria species, were synthesised for use in the PCR assay. In tests on purified genomic DNA from all seven species of Eimeria that infect the chicken, each of the four primer pairs amplified the ITS1 region from only their respective target species. The robustness of the approach was further demonstrated by the amplification of specific DNA fragments from tissues of experimentally infected animals and from oocysts recovered from field samples. We conclude that the ITS1 regions of Eimeria species contain sufficient inter-specific sequence variation to enable the selection of primers that can be applied in PCR analyses to detect and differentiate between species. In future work they may provide excellent markers for epidemiological studies.

show abstract

Section: Introductionmentioning

confidence: 99%

Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic.Eimeriaspecies of the chicken

et al. 1998

View full text Add to dashboard Cite

show abstract

“…Because different species and/or strains can vary in pathogenicity, drug resistance, and other biological parameters, the precise discrimination is important for epizootiological studies as well as for checking the purity of reference and/or vaccine strains. Different molecular markers have been used for species and strain differentiation, including isoenzymes (Shirley, 1975;Johnston & Fernando, 1997), RFLPs (Shirley, 1994), and RAPD (MacPherson & Gajadhar, 1993;Procunier et al, 1993;Shirley & Bumstead, 1994;Johnston & Fernando, 1995). Our group has recently described the development of RAPD assays for the intra-and inter-specific discrimination of Eimeria spp.…”

Section: Implications For Vector-controlmentioning

confidence: 99%

Round-Tables

2003

Rev. Inst. Med. trop. S. Paulo

View full text Add to dashboard Cite

show abstract

“…The diseases may be diagnosed based on the clinical symptoms, oocysts finding in the faeces and on the postmortem examination, it may be diagnosed based on Eimeria stadia finding in the chicken intestine (Soulsby, 1982;Morgan and Hawkins, 1995;Bowman, 2003). Recently, many molecular methods have been developed to diagnose coccidiosis such as: DNA (deoxyribonucleic acid) detection and identification (MacPherson and Gajadhar, 1993;Barker, 1990;Reischsl et al, 2003). According to Shirley (2000), the genom of E. tenella is 60 Mbp in the ca.…”

Section: Introductionmentioning

confidence: 99%

A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

Sumartono

2015

Indones. J. Biotechnol.

View full text Add to dashboard Cite

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe labeled with dig-11-dUTP, namely, 158,33 pg/µl, 52,25 pg/µl, 15,83 pg/µl and 5,225 pg/µl were tested to detect 0,6551 µg DNA target. The procedure of labeling and hybridization detection between DNA target with the molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection starter Kit I. The conclusion of the research was that 52,25 pg/µl molecular probe or more which its sequence GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA target by dot blot method.

show abstract

Differentiation of seven Eimeria species by random amplified polymorphic DNA

Cited by 45 publications

References 23 publications

Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic.Eimeriaspecies of the chicken

Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic.Eimeriaspecies of the chicken

Round-Tables

A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

Contact Info

Product

Resources

About