The objective of this research was to detect a minimum concentration of the probes that could be used for dot blot hybridization analysis. The method required labeled DNA probes. In this study a non-radioactive label of Digoxigenin-11-dUTP was used for labeling the Sag1 and the Bag1 of Toxoplasma gondii DNA probe. Labeling method for the probes was done according to the random primed labeling technique. The result showed that 0.67 pg/µl Sag1 probe and 0.58 pg/µl Bag1 probe could be detected by anti-Dig-antibody. It could be concluded that 0.67 pg/µl Sag1 probe and 0.58 pg/µl Bag1 probe could be used to diagnose toxoplasmosis by dot blot hybridization method.

The purpose of the research was to study a tissue cyst formation time Toxoplasma gondiiexperimentally. A number of 84 mice were divided randomly into four groups. Each group consisted of 21mice. The mice of the group I were infected with 101, II with 102 and III with 10 tachyzoites respectivelyintraperitoneally, whereas the group IV as a control (not infected with tachyzoites). All infected micewere treated with sulfadiazine, 15 mg/mouse per oral diluted in drinking water, for 5 days. On first untiltwenty first day after treatment one mouse of each group was necropsied. Liver, lymph, kidney, lung,heart, brain, or diaphragm muscle were then taken for histological preparations. Data on tissue cystformation time was analysed descriptively. The research revealed that innoculation with tachyzoites 103cyst could be found on day 14th after infection of liver, 102 cyst was found on the 6 day of liver, in day7th in heart and brain on day 10th of after infection, 103 cyst was found on day 4th inheart and brain in day 7thth in liver, day 6 after infection, while in the control dosage there is no formation similar to cyst found.Keywords: cyst, tissue, T. gondii, mice th1

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe labeled with dig-11-dUTP, namely, 158,33 pg/µl, 52,25 pg/µl, 15,83 pg/µl and 5,225 pg/µl were tested to detect 0,6551 µg DNA target. The procedure of labeling and hybridization detection between DNA target with the molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection starter Kit I. The conclusion of the research was that 52,25 pg/µl molecular probe or more which its sequence GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA target by dot blot method.