Differentiation of Staphylococcus aureus and Staphylococcus epidermidis by PCR for the fibrinogen binding protein gene

Abstract

Mastitis is one of the most common and burdensome diseases afflicting dairy animals. Among other causes of mastitis, staphylococci are frequently associated with clinical and subclinical mastitis. Although Staphylococcus aureus is the predominant species involved, Staphylococcus epidermidis and other coagulase-negative staphylococci are increasingly being isolated from cases of bovine mastitis. Although Staph. aureus and Staph. epidermidis can be easily differentiated based on their biochemical properties, such phenotypic identification is time consuming and laborious. This study aimed to rapidly identify Staph. aureus and Staph. epidermidis. Accordingly, a multiplex PCR was developed and we found that a single gene encoding the adhesin fibrinogen binding protein could be used to identify and differentiate the two species. Consequently, a multiplex reaction combining a triplex PCR for Staph. aureus and a duplex PCR for Staph. epidermidis was standardized, first using bacterial cultures and then with pasteurized milk spiked with live organisms or DNA extracted from the organisms. The test could specifically detect Staph. aureus and Staph. epidermidis even in the presence of a dozen other organisms. The limit of detection for detecting Staph. aureus and Staph. epidermidis separately was 10 to 100 cfu/mL for simplex PCR and 10 4 cfu/mL for multiplex PCR. Conversely, the limit was 10 6 cfu/ mL by multiplex PCR for simultaneous detection of both the organisms when spiked into culture medium or pasteurized milk. Overnight enrichment enhanced the assay sensitivity 100-fold. The assay had a high diagnostic sensitivity and specificity. The application of the test was verified on 602 field isolates of staphylococci that had been characterized earlier by phenotypic methods. Importantly, 25 coagulase-negative isolates were identified as Staph. aureus by the multiplex PCR. The test could be adapted for use in clinical diagnostic laboratories.

Lactic acid bacteria isolated from dairy products as potential producers of lipolytic, proteolytic and antibacterial proteins

“…epidermidis are the most contagious strains that produce bovine mastitis. For several years, milk producers, governments, and researchers have tried to reduce contamination by these microorganisms (Sunagar et al 2013 ). In this study, three strains (and all the fractions of these strains) of LAB examined inhibited Staphylococcus genus, which suggests that the use of LAB in dairy products has a promising future for the reduction of these microorganisms.…”

Incidence and Antibiotic Susceptibility Pattern of Staphylococcus spp. in Urinary Tract Infections (UTI), IRAN, 2013-2014

“…can be isolated from various environments (Sunagar et al, 2013). They are the most common medical microorganisms and are one of the most important human pathogenic agents.…”

The Outstanding Effect of Casein and α-Lactalbumin on Multidrug Resistance Staphylococcus aureus Isolated from Ready to Eat Meat Products and Human Samples

“…51304) was used for DNA extraction from meat and human samples. PCR was implemented using Applied Biosystem Thermal Cycler 2720 for detection of 23S rRNA gene with primer sequence F: ACGGAGTTACAAAGGACGAC, and R: AGCTCAGCCTTAACGAGTAC with 1250 bp according to (Sunagar et al, 2010). The cycling condition was modified as following, 94˚C for 5 min, then 35 cycles for 45 sec at 94˚C, 45 sec at 55˚C, 1 min at 72˚C, and final extension for 12 min at 72˚C.…”