Direct Sequencing of RNA with MinION Nanopore: Detecting Mutations based on Associations

Abstract

These authors contributed equally One of the key challenges in the field of RNA virus genetics is the inference of full haplotypes from next generation sequencing data. The MinION Oxford Nanopore sequencer allows sequencing very long reads, with the potential of sequencing the complete genomes of RNA viruses in individual reads. However, MinION suffers from high error rates, rendering the detection of true viral mutations very difficult. Here we propose a new statistical approach to differentiate between true mutations and sequencing errors from direct RNA sequencing using MinION. Our strategy relies on the assumption that sequencing errors will be dispersed randomly along sequencing reads, and hence will not be associated with each other, whereas real mutations will display a non-random pattern of association with other mutations. We demonstrate our approach using direct RNA sequencing data from an evolved population of the MS2 bacteriophage, whose genome length of 3,569 base pairs makes it ideal for MinION. Our results pinpointed several mutations in the phage genome that were corroborated using parallel Illumina sequencing, allowing us to reconstruct associations between mutations. Our approach is amenable to long read sequencing data from any organism for accurate detection of bona fide mutations.

Competition between social cheater viruses is driven by mechanistically different cheating strategies

“…To test whether the various presumably defective mutants are independent or not, we performed direct long-read RNA sequencing using MinION by Oxford Nanopore. We sequenced more than 15,000 full genomes from p15 of lines A and B and used an approach that we have recently developed to overcome the high error rate of MinION (Methods) (44). Our results revealed that 1764 and the second most prominent mutation in the experiment, A1664G, are independent and do not reside on the same genomes.…”

“…Illumina MiSeq library preparation and read alignment were performed as described in (44). Briefly, the MS2 RNA was reverse-transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific), using 3R primer (TGGGTGGTAACTAGCCAAGCAG).…”

“…The Oxford Nanopore MinION was used to directly sequence the MS2 RNA genome. We sequenced p15A and p15B in separate runs, as described in detail in (44). Alignment was performed using BLAST with parameters of minimal percent identity of 60 and E-value threshold of 1 × 10 −7 to allow the highly variable MinION reads to map.…”

VirStrain: a strain identification tool for RNA viruses

“…As pointed out in [ 6 ], it is difficult to give a universal definition of microbial strain. Depending on the context, strain can refer to a virus variant with unique and stable phenotypic characteristics under natural conditions [ 7 ], or a specific viral genome [ 3 , 6 , 8 – 10 ]. In this context, strain refers to a specific viral genome.…”

Nanopore sequencing: a rapid solution for infectious disease epidemics

“…The Nanopore sequencing platforms sequence DNA or RNA in one run. Nanopore DNA sequencing technology was developed first, with lower error rates (the per-nucleotide error rate is~5%-15% (Luo et al, 2019)) and higher throughput than direct Nanopore RNA sequencing (the pernucleotide error rate is approximately 17.02% (Harel et al, 2019)). During the Ebola outbreak in Guinea, Quick et al designed an entire sequencing system based on the MinION platform of the ONT Company, which could be accommodated in a single ordinary test bed, for real-time genome monitoring of the epidemic (Quick et al, 2016).…”