Directed evolution of retroviruses activatable by tumour-associated matrix metalloproteases

Abstract

Protease-activatable retroviral vectors offer the possibility of targeted gene transfer into cancer cells expressing a unique set of proteases as, for example, the matrix metalloproteases (MMPs). However, it is difficult to predict which substrate sequence will be optimally cleaved by a given tumour cell type. Therefore, we developed a novel approach that allows the selection of MMP-activatable retroviruses from libraries of viruses displaying combinatorially diversified protease substrates. Starting from a virus harbouring a standard MMP-2 substrate motif, after only two consecutive cycles of diversification and in vivo selection, MMP-activatable viruses were recovered. Biochemical characterization of the selected viruses revealed that their linker peptides showed a considerably increased sensitivity for MMP-2 cleavage, and interestingly also improved the particle incorporation rate of the Env protein. Owing to the optimized linker peptide, the selected viruses exhibited a greatly enhanced spreading efficiency through human fibrosarcoma cells, while having retained the dependency on MMP activation. Moreover, cell entry efficiency and virus titres were considerably improved as compared to the parental virus displaying the standard MMP-2 substrate. The results presented imply that retroviral protease substrate libraries allow the definition of MMP substrate specificities under in vivo conditions as well as the generation of optimally adapted tumour-specific viruses.

Library-based selection of retroviruses selectively spreading through matrix metalloprotease-positive cells

“…Previous selections based on virus libraries using the EGF-blocking domain resulted in viruses that were MMP-dependent on EGF-receptor positive cells only. 12 Using the blocking domain CD40L, we present the first study describing the generation of retroviruses with restricted host range by molecular evolution. Starting from an MMP-activatable virus that was unable to spread completely through the fibrosarcoma cell line HT1080, our process of diversifying the linker peptide serving as protease substrate and selecting for efficient virus spreading ended up with several virus clones that were orders of magnitude more efficient in spreading than the parental virus, but retained its targeting capabilities.…”

“…From this, as well as previous studies, it is evident that the blocking domain must be removed only from a fraction of Env molecules in a given virus particle to activate infection. 3,12 It is, however, unclear how large this fraction exactly has to be. As the C-AK-A virus showed the lowest amounts of activated Env molecules in the supernatant of U87-MG cells but was more efficient in spreading through these cells than the C-PS-A virus, this threshold level may in fact vary with the type of linker peptide displayed.…”

“…Both fulfilled the PXXkHy consensus of substrates susceptible to a broad range of MMPs. 12,15 The AKGLYK peptide, in contrast, may serve as substrate of an even broader spectrum of proteases. HT1080 and U87-MG cells are known to express not only a number of different MMPs but also plasmin and the urokinase plasmin activator, both serine proteases that require positively charged residues in their substrates, which in fact are present in the AKGLYK linker peptide.…”

“…12 To insert protease-cleavable or diversified linker peptideencoding regions, the SfiI-NotI cassette of pC-A was exchanged against SfiI/NotI-digested PCR fragments generated with the universal primer CB6(+) 5 0 -CCCC TAATCCCCTTAATTCTTC-3 0 and primers IH9(À) 5 0 -CG AAGCTGCGGCCGCCGCCCACAGTCCTAGCGGGCTG CTAGCGAGTTTGAGTAAGCCAAAGGAC-3 0 for pC-MMP-A, IH10(À) 5 0 -CGAAGCTGCGGCCGCCTGGTAC AGGCCCTGGGGGCTGCTAGCGAGTTTGAGTAAGCC AAAGGAC-3 0 for pC-26-A, IH11(À) 5 0 -CGAAGCTGC GGCCGCCTTGTACAGGCCCTTGGCGCTGCTAGCGAG TTTGAGTAAGCCAAAGGAC-3 0 for pC-AK-A, IH12(À) 5 0 -CGAAGCTGCGGC CGCCTGGTACAGTCCGCTGGG GCTGCTAGCGAGTTTGAGTAAGCCAAAGGAC-3 0 for pC-PS-A or IH3(À) 5 0 -CGAAGCTGCGGCCGCNDNRDN CAGTCCNDNRDNGCTGCTAGCGAGTTTGAGTAAGC CAAAGGAC-3 0 for pC-X4-A using pC-A as template. Degenerated codons are labelled in italics, the NotI restriction site is underlined.…”

“…In the latter libraries key residues in the linker peptide had been randomized such that the inadvertent introduction of furin protease cleavage signals is avoided. 12 The selected MMP-activatable retroviruses showed a considerably enhanced spreading efficiency in tumour cells due to an about 10-fold enhanced cell entry kinetic and an improved susceptibility for MMP-2, which mediates the invasion of tumour cells by degradation of the extracellular matrix. 13 However, these EGF-displaying viruses are able to infect cells with low EGF receptor density at an unimpaired efficiency.…”