DNA barcoding of five species of groupers (Pisces: Serranidae) off Visakhapatnam, central eastern coast of India

Deepti, Vaddiparti Iswarya; Kandula, Sujatha; Khedkar, G.D.

doi:10.1080/24701394.2017.1339188

Cited by 5 publications

(5 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This might be explained by the obvious physical differences between the observed species (Craig et al 2011;Froese and Pauly 2023). In addition, the number of species reported in this study is comparable with studies by Deepti et al (2018), who barcoded five grouper species from Visakhapatnam (India), and Basith et al (2021), who DNA barcoded seven grouper species from Madura (Indonesia). However, the number of reported species is lower compared to studies by Alcantara and Yambot (2016) and Tapilatu et al (2021), who barcoded 26 and 16 species of commercial grouper from the Philippines and Papua (Indonesia), respectively.…”

Section: Discussionsupporting

confidence: 85%

DNA Barcoding of Six Commercially Important Groupers (Epinephelidae) from Langsa, Aceh, Indonesia

Fadli,

Jumiati,

Razi

et al. 2023

HAYATI J Biosci

View full text Add to dashboard Cite

Groupers are among the fish groups that are difficult to recognize due to their high morphological similarities. Therefore, molecular techniques, particularly DNA barcoding, are extensively utilized to differentiate this fish group. This study aimed to analyze and validate six grouper species belonging to the Epinephelidae family that were harvested from Langsa district waters in Aceh province, Indonesia, based on DNA barcode data. It was conducted from June to December 2021, with the fish specimens collected from fishers at fish landing sites and the fish market in Langsa City, Aceh province. A total of 22 grouper sequences belonging to six species were generated, namely Epinephelus coioides, E. bleekeri, E. malabaricus, E. erythrurus, E. sexfasciatus and Mycteroperca poecilonotus (formerly Epinephelus poecilonotus). Genetic distance within these species ranged from 0.10 to 0.73% (average: 0.40%). Notably, E. malabaricus and E. coioides exhibited the closest genetic kinship (4.07%), while E. sexfasciatus and M. poecilonotus displayed the greatest genetic distance (19.33%). This study provides the first DNA reference for grouper in Langsa district, Indonesia, with significant implications for future sustainable grouper management.

show abstract

Section: Discussionsupporting

confidence: 85%

DNA Barcoding of Six Commercially Important Groupers (Epinephelidae) from Langsa, Aceh, Indonesia

Fadli,

Jumiati,

Razi

et al. 2023

HAYATI J Biosci

View full text Add to dashboard Cite

show abstract

“…Identification of groupers based on morphological characteristics may be inconclusive [7,22,24,26,41] and even a single systematic external morphological characteristic has not yet been found to differentiate these commercially important groupers [6]. Hence, in this study, to overcome the taxonomical confusion raised by the overlapping characteristics of closely allied Epinephelus species, an attempt has been made by using DNA barcoding as a promising molecular approach to discriminate the species.…”

Section: Discussionmentioning

confidence: 99%

“…In addition to the color pattern and morphological characteristics, the species-specific characteristics, like pyloric caeca [6,15], scales, and otoliths [16][17][18], and vertebrae [19][20][21], are proved to be more useful for the identification of species. Furthermore, the advanced molecular technique, such as DNA barcoding, helps in resolving the ambiguity at species-level identification [22][23][24][25][26][27]. Hence, this study has been carried to identify and validate E. areolatus along Nizampatnam coast, Andhra Pradesh, India, using morphomeristic characteristics, including pyloric caeca, vertebrae, scales, otoliths, and DNA barcoding.…”

Section: Introductionmentioning

confidence: 99%

Taxonomic validation of Areolate grouper, Epinephelus areolatus(Perciformes: Serranidae) along the Nizampatnam coast, India

Chatla¹,

Padmavathi²,

Srinu³

2020

J Appl Biol Biotech

View full text Add to dashboard Cite

Groupers (Perciformes: Serranidae: Epinephelinae) are a significant group of marine and estuarine fishes having ecological and commercial importance in tropical and subtropical waters. The genus Epinephelus is identified based on the color configuration and morphological characteristics. The homogeneity in the morphological characteristics has created confusion in the species identification of Epinephelus. Epinephelus areolatus with its delicious taste has high economic value; however, its population showed a remarkable decline in recent times due to overfishing. Due to morphological resemblance, it has often been confused with Epinephelus chlorostigma and Epinephelus bleekeri, which leads to misidentification. Hence, correct identification of species is needed for the proper management of fish resources. This study aims to identify and validate E. areolatus by using morpho-meristic characteristics, including the number and pattern of pyloric caeca, vertebrae count through radiograph imaging, scale and otolith morphology, and DNA barcoding. The morphological and meristic characteristics of Epinephelus species observed in Nizampatnam coast are strikingly comparable to those reported earlier as E. areolatus. Comparative molecular analysis was also carried along with other morphologically similar species, viz. E. chlorostigma and E. bleekeri, using mitochondrial cytochrome oxidase I gene sequences. The mean interspecific genetic distance revealed high similarity with E. bleekeri (0.109 ± 0.012) and low similarity with E. chlorostigma (0.079 ± 0.009). The neighbor-joining tree has shown distinct clades for three species with high bootstrap values. The partial DNA sequence of the mitochondrial cytochrome oxidase I was established for the first time for E. areolatus from the Nizampatnam coast in this study.

show abstract

“…DNA barcoding using Cytochrome Oxidase subunit 1 (COI) markers has been previously reported to be used in grouper subfamily: Epinephelinae (Aziz et al 2016), especially grouper of Epinephelus genus (Deepti et al 2018;Qu et al 2018;Ariyanti et al 2019;Durand et al 2020;Basith et al 2021). Additionally, previous reports also perform the DNA barcoding and phylogenetic study on Epinephelus spp.…”

Section: Introductionmentioning

confidence: 99%

Molecular phylogeny of grouper of Epinephelus genus in Jayapura, Papua, Indonesia inferred from Cytochrome Oxidase I (COI) gene

et al. 2022

View full text Add to dashboard Cite

Abstract. Dwifajri S, Tapilatu RF, Pranata B, Kusuma AB. 2022. Molecular phylogeny of grouper of Epinephelusgenus in Jayapura, Papua, Indonesiainferred from Cytochrome Oxidase I (COI) gene. Biodiversitas 23: 1449-1456. Grouper (Serranidae: Epinephelinae: Epinephelus) fish have high economic value, and are relatively overfis hed, yet have not received serious attention to determine conservation status by the International Union for Conservation of Nature (IUCN). DNA barcoding is an important molecular approach to identify Papua's grouper species. The objective of the present study was to analyze species diversity and molecular phylogeny of Epinephelus grouper based on DNA sequences of mitochondrial control region COI gene. Samples of grouper fish were collected from Hamadi, Sentani, and Youtefa local fish markets in Jayapura, Papua during August 2020. Grouper was morphologically identified, photographed and its fin was clipped and preserved for molecular analysis. Present study used primers, i.e., Fish R1 5'TAGACTTCTGGCCAAGAATCA3' and Fish F1 5'TCAACCAACCACAAAGACATTGGCA3'. Based on gene bank comparison at the sequence length 689 base pairs, the present study obtained seven species of grouper (Serranidae: Epinephelinae), namely Epinephelus areolatus, Epinephelus coioides, Epinephelus episictus, Epinephelus kupangensis, Epinephelus macrospilos, Epinephelus melanostigma and Epinephelus merra. The phylogenetic tree was composed of seven clades, where each grouper species represented each clade. The genetic distance between Epinephelus kupangensis and Epinephelus melanostigma was determined as the closest genetic distance (0.123) in the present study, while the farthest one was found between Epinephelus episictus and Epinephelus merra (0.161).

show abstract

DNA barcoding of five species of groupers (Pisces: Serranidae) off Visakhapatnam, central eastern coast of India

Cited by 5 publications

References 14 publications

DNA Barcoding of Six Commercially Important Groupers (Epinephelidae) from Langsa, Aceh, Indonesia

DNA Barcoding of Six Commercially Important Groupers (Epinephelidae) from Langsa, Aceh, Indonesia

Taxonomic validation of Areolate grouper, Epinephelus areolatus(Perciformes: Serranidae) along the Nizampatnam coast, India

Molecular phylogeny of grouper of Epinephelus genus in Jayapura, Papua, Indonesia inferred from Cytochrome Oxidase I (COI) gene

Contact Info

Product

Resources

About