Molecular phylogeny of grouper of Epinephelus genus in Jayapura, Papua, Indonesia inferred from Cytochrome Oxidase I (COI) gene

Abstract

Abstract. Dwifajri S, Tapilatu RF, Pranata B, Kusuma AB. 2022. Molecular phylogeny of grouper of Epinephelusgenus in Jayapura, Papua, Indonesiainferred from Cytochrome Oxidase I (COI) gene. Biodiversitas 23: 1449-1456. Grouper (Serranidae: Epinephelinae: Epinephelus) fish have high economic value, and are relatively overfis hed, yet have not received serious attention to determine conservation status by the International Union for Conservation of Nature (IUCN). DNA barcoding is an important molecular approach to identify Papua's grouper species. The objective of the present study was to analyze species diversity and molecular phylogeny of Epinephelus grouper based on DNA sequences of mitochondrial control region COI gene. Samples of grouper fish were collected from Hamadi, Sentani, and Youtefa local fish markets in Jayapura, Papua during August 2020. Grouper was morphologically identified, photographed and its fin was clipped and preserved for molecular analysis. Present study used primers, i.e., Fish R1 5'TAGACTTCTGGCCAAGAATCA3' and Fish F1 5'TCAACCAACCACAAAGACATTGGCA3'. Based on gene bank comparison at the sequence length 689 base pairs, the present study obtained seven species of grouper (Serranidae: Epinephelinae), namely Epinephelus areolatus, Epinephelus coioides, Epinephelus episictus, Epinephelus kupangensis, Epinephelus macrospilos, Epinephelus melanostigma and Epinephelus merra. The phylogenetic tree was composed of seven clades, where each grouper species represented each clade. The genetic distance between Epinephelus kupangensis and Epinephelus melanostigma was determined as the closest genetic distance (0.123) in the present study, while the farthest one was found between Epinephelus episictus and Epinephelus merra (0.161).

Population dynamics of reef fish in the Kwandang Bay, Sulawesi Sea, Indonesia

“…Groupers are a major target of the reef fisheries operating in almost all Indonesian coral reef areas due to their high market value and rising market demand (Khasanah et al 2019). In recent years there has been a shift in market demand patterns from frozen fish to fresh and live fish products (Khasanah et al 2020), prompting an increase in the use of destructive fishing methods, in particular the use of poisons, to satisfy the demand for live reef fish (Setiawan et al 2019;Dwifajri et al 2022).…”

“…Groupers are arguably the most intensively exploited group of coral reef-associated fish, especially in the Live Reef Fish Food Trade (LRFFT); they are a highly-priced commodity much in demand in both domestic and export markets (Jefri et al 2015;Damora et al 2021;Dwifajri et al 2022). With the rising global demand for reef fish, the LRFFT in general and the grouper export trade, in particular, have made significant contributions to the Indonesian economy, both financially and in terms of employment, with annual export values reaching 571 billion IDR (MMAF 2020).…”

DNA Barcoding and Morphological Characters of Two Trevally Fish species (Caranx Spp.) Collected from Youtefa Bay, Papua, Indonesia

“…The farthest genetic distance is in clade 2 with a value of 0.0023 and the closest genetic distance is clade 4 which is 0.0188 (Table 3.). The smaller the genetic distance, the closer the similarity, and may indicate that a particular species may have similar origins (Tapilatu et al, 2021;Dwifajri et al, 2022).…”

Phylogenetic of red snapper (Lutjanidae) in Yapen Island Waters, Papua, Indonesia

“…We identified red snappers using morphological and molecular analysis approaches, so the results were perfectly accurate. Combining morphological and molecular approaches can reduce taxonomic ambiguity in observed species (Dwifajri et al 2022). The combination of the two approaches is very much needed because of the high morphological similarity between red snapper species within one genus and between genera.…”