DNA Oxidation in Anionic Reverse Micelles:  Ruthenium-Mediated Damage at Guanine in Single- and Double-Stranded DNA

Abstract

One-electron guanine oxidation in DNA has been investigated in anionic reverse micelles (RMs). A photochemical method for generating Ru3+ from the ruthenium polypyridyl complex tris(2-2'-bipyridine)ruthenium(II) chloride ([Ru(bpy)3]Cl2) is combined with high-resolution polyacrylamide gel electrophoresis (PAGE) to quantify piperidine-labile guanine oxidation products. As characterized by emission spectroscopy of Ru(bpy)3(2+), the addition of DNA to RMs containing Ru(bpy)3(2+) does not perturb the environment of Ru(bpy)3(2+). The steady-state quenching efficiency of Ru(bpy)3(2+) with K3[Fe(CN)6] in buffer solution is approximately 2-fold higher than that observed in RMs. Consistent with the difference in quenching efficiency in the two media, a 1.5-fold higher yield of piperidine-labile damage products as monitored by PAGE is observed for duplex oligonucleotide in buffer vs RMs. In contrast, a 13-fold difference in the yield of PAGE-detected G oxidation products is observed when single-stranded DNA is the substrate. Circular dichroism spectra showed that single-stranded DNA undergoes a structural change in anionic RMs. This structural change is potentially due to cation-mediated adsorption of the DNA phosphates on the anionic headgroups of the RMs, leading to protection of the guanine from oxidatively generated damage.

ACC/AHA/SCAI 2005 guideline update for percutaneous coronary intervention—summary article: A report of the American college of cardiology/American heart association task force on practice guidelines(ACC/AHA/SCAI writing committee to update the 2001 guidelines for percutaneous coronary intervention)

“…Structural studies (Figures 12a–12c) on the oligonucleotides in buffer and in the RM show insignificant perturbation of the B‐form upon encapsulation of the synthetic DNA molecules in the RM. Our observations are consistent with a recent report of insignificant structural perturbation of (GATGAGAGTTAGTGATGAGTG) 2 oligonucleotide in AOT RM 37. The structures of the RMs with oligonucleotides as evidenced from DLS studies (Figure 12d) are similar to that of the RMs with the genomic DNA (Figure 4b).…”

Ligand–DNA interaction in a nanocage of reverse micelle

“…Our observations are consistent with a recent report of insignificant structural perturbation of (GATGAGAGTTAGTGATGAGTG) 2 oligonucleotide in AOT RM. 37 The structures of the RMs …”

Photophysical properties of amphiphilic ruthenium(ii) complexes in micelles

“…[21][22][23][24][25][26][27][28] [Ru(NN) 3 ] 2+ complexes have been extensively used as probes in micellar media and their photophysical properties, such as wavelength of emission maximum, emission intensity, excited state lifetime and emission quantum yield, vary enormously with the nature of the surfactant and concentration. [28][29][30][31][32][33][34][35] Many researchers [30][31][32][33][34][35][36][37][38][39][40][41] have reported the binding, partitioning and photosensitization of [Ru(NN) 3 ] 2+ complexes in both ionic and nonionic surfactant media. Demas and coworkers [38][39][40][41][42][43] have studied the interaction of [Ru(NN) 3 ] 2+ complexes with ionic (CTAB and SDS) and neutral micelles (Triton X-100) and found the emission spectra, lifetimes and quantum yields change dramatically upon micellization.…”