Dynamics of Fat Mass in DUhTP Mice Selected for Running Performance - Fat Mobilization in a Walk

Abstract

Objective: Reduction of body fat can be achieved by dietary programs and/or aerobic exercise training. More convenient methods to rid the body of excess fat are needed. However, it is unclear whether it is possible to more easily lose body weight at all. Methods: DUhTP mice bred through phenotype selection for high treadmill performance and unselected controls were voluntarily physically active in a running wheel over a period of 3 weeks. Phenotypical data were collected, and subcutaneous fat was analyzed for expression of mitochondria-relevant proteins. Results: Voluntary physical activity over 3 weeks exclusively in DUhTP mice severely reduced subcutaneous (-38%; p < 0.05) and epididymal (-32%; p < 0.05) fat. Following mild physical activity, subcutaneous fat derived from DUhTP mice showed increased levels of long chain acyl dehydrogenase (LCAD; +230%; p < 0.05) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1-α; p < 0.01). Mitochondrial transcription factor A (Tfam) expression was similar in both sedentary genotypes but physical activity increased Tfam levels exclusively in DUhTP (p < 0.05). Conclusion: Our findings indicate that the mitochondrial mass is highly active in DUhTP mice and responsive even to mild physical activity. While genetic predisposition could not prevent fat accretion in DUhTP mice, voluntary activity was sufficient to reduce excess body fat almost completely.

Browning of subcutaneous fat and higher surface temperature in response to phenotype selection for advanced endurance exercise performance in male DUhTP mice

“…Our marathon mouse model DUhTP, established by long-term selection for high treadmill performance, is characterized by increased hepatic lipogenesis on one hand and peripheral obesity on the other, if compared to unselected control mice (DUC) (Brenmoehl et al 2013). For the sake of clarity, we included Table 1 in our manuscript providing published data on increased fat accretion in DUhTP mice (Brenmoehl et al 2015). Notably, in DUhTP also irisin concentrations were found being increased in skeletal muscle and plasma (Brenmoehl et al 2014).…”

“…Expression of different mRNA transcripts in subcutaneous fat samples (n = 7) was analyzed in triplicates as described previously (Brenmoehl et al 2014, 2015). Primers used are mTbx1-forw: ggcaggcagacgaatgttc, mTbx1-rev: ttgtcatctacgggcacaaag, UCP1-forw: ggcctctacgactcagtcca, UCP1-rev: taagccggctgagatcttgt, Tcf21-forw: cattcacccagtcaacctga, Tcf21-rev: ttccttcaggtcattctctgg, Fndc5-forw: caacgagcccaataacaaca, Fndc5-rev: agaaggtcctctcgcattctc.…”

“…Primers used are mTbx1-forw: ggcaggcagacgaatgttc, mTbx1-rev: ttgtcatctacgggcacaaag, UCP1-forw: ggcctctacgactcagtcca, UCP1-rev: taagccggctgagatcttgt, Tcf21-forw: cattcacccagtcaacctga, Tcf21-rev: ttccttcaggtcattctctgg, Fndc5-forw: caacgagcccaataacaaca, Fndc5-rev: agaaggtcctctcgcattctc. Different housekeeping genes (Brenmoehl et al 2015) were tested to identify the HKG with comparable Crossing point (Cp)-values (Cp Rplp2 : DUhTP: 24.45 ± 1.17; DUC: 25.80 ± 1.03) to normalize expression of Tbx1 and Ucp1 .…”

“…In the sedentary condition, marathon mice accumulate high amounts of body fat in external depots indicating physiological relevance of lipids for superior endurance exercise performance in DUhTP mice. In fact, recent work revealed that external fat mass in DUhTP mice is highly responsive to physical activity because voluntary exercise in running wheels completely abolished the obese phenotype of DUhTP mice (Brenmoehl et al 2015). In subcutaneous fat from DUhTP mice, PGC1-α and mitochondrial DNA content were increased and it was speculated that fat cell browning may occur in subcutaneous white adipocytes (Brenmoehl et al 2015).…”

“…In fact, recent work revealed that external fat mass in DUhTP mice is highly responsive to physical activity because voluntary exercise in running wheels completely abolished the obese phenotype of DUhTP mice (Brenmoehl et al 2015). In subcutaneous fat from DUhTP mice, PGC1-α and mitochondrial DNA content were increased and it was speculated that fat cell browning may occur in subcutaneous white adipocytes (Brenmoehl et al 2015). It is known that brite adipocytes, converted from white adipocytes, exhibit properties of brown adipocytes like expression of UCP1 and a proposed mechanism for the induction of browning in WAT may occur by irisin derived from muscle after contraction (Bostrom et al 2012) or from the fat independent of physical exercise (Roca-Rivada et al 2013).…”