E-cadherin mediates the aggregation of breast cancer cells induced by tamoxifen and epidermal growth factor

Mauro, Loredana; Pellegrino, Michele; Lappano, Rosamaria; Vivacqua, Adele; Giordano, Francesca; Palma, M. Grazia; Andò, Sebastiano

doi:10.1007/s10549-009-0456-4

Cited by 9 publications

(8 citation statements)

References 59 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The pro-differentiation action of ER-β is mediated in part via direct transcriptional upregulation of E-cadherin, in turn repressing the oncogenic Wnt pathway via nuclear β-catenin [ 36 ]; the association of low ER-β levels with tamoxifen resistance and reduced survival benefit from adjuvant hormone therapy [ 37 ] may therefore be clinically relevant to ILC. Unlike in ILC where the function of the cadherin-catenin complex is irreversibly repressed (i.e., even if E-cadherin remains expressed [ 38 ]) and hence inhibits apoptosis [ 39 ], tamoxifen therapy of ER-positive IDC cells appears capable of restoring E-cadherin-dependent adhesion and augment apoptosis [ 40 ].…”

Section: Discussionmentioning

confidence: 99%

Lobular breast cancers lack the inverse relationship between ER/PR status and cell growth rate characteristic of ductal cancers in two independent patient cohorts: implications for tumor biology and adjuvant therapy

et al. 2014

View full text Add to dashboard Cite

BackgroundAlthough invasive lobular carcinoma (ILC) of the breast differs from invasive ductal carcinoma (IDC) in numerous respects - including its genetics, clinical phenotype, metastatic pattern, and chemosensitivity - most experts continue to manage ILC and IDC identically in the adjuvant setting. Here we address this discrepancy by comparing early-stage ILC and IDC in two breast cancer patient cohorts of differing nationality and ethnicity.MethodsThe clinicopathologic features of 2029 consecutive breast cancer patients diagnosed in Hong Kong (HK) and Australia (AUS) were compared. Interrelationships between tumor histology and other clinicopathologic variables, including ER/PR and Ki67, were analysed.ResultsTwo hundred thirty-nine patients were identified with ILC (11.8%) and 1790 patients with IDC. AUS patients were older (p <0.001) and more often postmenopausal (p <0.03) than HK patients. As expected, ILC tumors were lower in grade and proliferative rate, and more often ER-positive and HER2-negative, than IDC (p <0.002); yet despite this, ILC tumors were as likely as IDC to present with nodal metastases (p >0.7). Moreover, whereas IDC tumors exhibited a strongly negative relationship between ER/PR and Ki67 status (p <0.0005), ILC tumors failed to demonstrate any such inverse relationship (p >0.6).ConclusionThese data imply that the primary adhesion defect in ILC underlies a secondary stromal-epithelial disconnect between hormonal signaling and tumor growth, suggesting in turn that this peritumoral feedback defect could reduce both the antimetastatic (adjuvant) and tumorilytic (palliative) efficacy of cytotoxic therapies for such tumors. Hence, we caution against assuming similar adjuvant chemotherapeutic survival benefits for ILC and IDC tumors with similar ER and Ki67, whether based on immunohistochemical or gene expression assays.

show abstract

Section: Discussionmentioning

confidence: 99%

Lobular breast cancers lack the inverse relationship between ER/PR status and cell growth rate characteristic of ductal cancers in two independent patient cohorts: implications for tumor biology and adjuvant therapy

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Reversing CpG hypermethylation in the promoter region of the E-cadherin gene could re-activate E-cadherin gene expression (21,22). It has been proposed that targeting signal transduction pathways such as EGFR and ER may be a more promising method with which to restore E-cadherin levels (23)(24)(25)(26).…”

Section: Discussionmentioning

confidence: 99%

β-elemene decreases cell invasion by upregulating E-cadherin expression in MCF-7 human breast cancer cells

Zhang

2013

Oncology Reports

View full text Add to dashboard Cite

Inactivation of E-cadherin results in cell migration and invasion, hence leading to cancer aggressiveness and metastasis. Downregulation of E-cadherin is closely correlated with a poor prognosis in invasive breast cancer. Thus, re-introducing E-cadherin is a novel strategy for cancer therapy. The aim of the present study was to determine the effects of the traditional Chinese medicine, β-elemene (ELE), on E-cadherin expression, cell migration and invasion in the breast cancer cell line MCF-7. MCF-7 cells were treated with 50 and 100 µg/ml ELE. E-cadherin mRNA was analyzed by reverse transcription‑polymerase chain reaction. E-cadherin protein levels were determined by immunofluorescence and western blot assays. Cell motility was measured by a Transwell assay. ELE increased both the protein and mRNA levels of E-cadherin, accompanied by decreased cell migration and invasion. Further analysis demonstrated that ELE upregulated estrogen receptor‑α (ERα) and metastasis-associated protein 3 (MTA3), and decreased the nuclear transcription factor Snail. In conclusion, our results demonstrate that ELE decreases cell migration and invasion by upregulating E-cadherin expression via controlling the ERα/MTA3/Snail signaling pathway.

show abstract

“…MDA‐MB‐231, MCF‐7, ZR75, and T47D cells were treated with adiponectin 1 and 5 μg/ml or left untreated for 1 hour and then DNA/protein complexes were extracted as described (22). A5 μl volume of each sample and input were used for PCR amplification using the primers flanking Sp1 sequence in the human CD1 promoter region: 5′‐GGCGATTTGCATTTCTATGA‐3′ and 5′‐GCCCGAAACTAGAAACGAATT‐3′.…”

Section: Methodsmentioning

confidence: 99%

“…Protein extracts were subjected to SDS-PAGE as described (22). Immunoblots show a single representative of 3 separate experiments.…”

Section: Immunoblot Analysismentioning

confidence: 99%

“…(continued from previous page) corepressor; pCAF, P300/CBP-associated factor; Pol, polymerase; siRNA, small interfering RNA; SMRT, silencing mediator for retinoid and thyroid receptor; Sp1, specific protein 1; STAT, signal transducer and activator of transcription Chromatin immunoprecipitation and rechromatin immunoprecipitation assays MDA-MB-231, MCF-7, ZR75, and T47D cells were treated with adiponectin 1 and 5 mg/ml or left untreated for 1 hour and then DNA/protein complexes were extracted as described (22). A 5 ml volume of each sample and input were used for PCR amplification using the primers flanking Sp1 sequence in the human CD1 promoter region: 59-GGCGATTTGCATTTCTATGA-39 and 59-GCCCGAAACTAGAAACGAATT-39.…”

Section: Transfections and Luciferase Assaysmentioning

confidence: 99%

See 1 more Smart Citation

Estrogen receptor‐α drives adiponectin effects on cyclin D1 expression in breast cancer cells

et al. 2015

Self Cite

View full text Add to dashboard Cite

Obesity is a risk factor for breast cancer, largely due to altered expression of various adipocytokines. As it concerns adiponectin, there are not univocal results regarding its role in breast cancer occurrence and progression. Here, we demonstrate that in animals injected with human estrogen receptor (ER)-a-negative MDA-MB-231 cells pretreated with adiponectin (1 and 5 mg/ml), a significant reduction (60 and 40%, respectively) in tumor volume is observed, whereas an increased tumor growth (54 and 109%, respectively) is evidenced in the animals receiving human ER-a-positive MCF-7 cells. Moreover, cyclin D1 (CD1) mRNA and protein levels are decreased in MDA-MB-231 cells, whereas they are upregulated in ER-a-positive cells by adiponectin. These findings fit with the opposite effects of adiponectin on CD1 promoter: 0.44-and 0.34-fold decrease in MDA-MB-231 cells and 0.63-and 0.95-fold increase in MCF-7 cells, treated with 1 and 5 mg/ml, respectively. Functional studies indicate that these effects are mediated by the specific protein 1 motif located in the CD1 promoter. In the absence of ER-a, the adiponectin-mediated downregulation of CD1 involves the recruitment of corepressors. In the presence of ER-a, the adiponectin-induced expression of CD1 requires the involvement of an activator complex. In conclusion, we propose that a possible mechanism through which adiponectin differently affects breast cancer growth is the opposite modulation of CD1 levels accordingly to ER-a

show abstract

E-cadherin mediates the aggregation of breast cancer cells induced by tamoxifen and epidermal growth factor

Cited by 9 publications

References 59 publications

Lobular breast cancers lack the inverse relationship between ER/PR status and cell growth rate characteristic of ductal cancers in two independent patient cohorts: implications for tumor biology and adjuvant therapy

Lobular breast cancers lack the inverse relationship between ER/PR status and cell growth rate characteristic of ductal cancers in two independent patient cohorts: implications for tumor biology and adjuvant therapy

β-elemene decreases cell invasion by upregulating E-cadherin expression in MCF-7 human breast cancer cells

Estrogen receptor‐α drives adiponectin effects on cyclin D1 expression in breast cancer cells

Contact Info

Product

Resources

About