Early Alterations in Ovarian Surface Epithelial Cells and Induction of Ovarian Epithelial Tumors Triggered by Loss of FSH Receptor

Abstract

Little is known about the behavior of the ovarian surface epithelium (OSE), which plays a central role in ovarian cancer etiology. It has been suggested that incessant ovulation causes OSE changes leading to transformation and that high gonadotropin levels during postmenopause activate OSE receptors, inducing proliferation. We examined the chronology of OSE changes, including tumor appearance, in a mouse model where ovulation never occurs due to deletion of follitropin receptor. Changes in epithelial cells were marked by pan-cytokeratin (CK) staining. Histologic changes and CK staining in the OSE increased from postnatal day 2. CK staining was observed inside the ovary by 24 days and increased thereafter in tumor-bearing animals. Ovaries from a third of aged (1 year) mutant mice showed CK deep inside, indicating cell migration. These tumors resembled serous papillary adenoma of human ovaries. Weak expression of GATA-4 and elevation of PCNA, cyclooxygenase-1, cyclooxygenase-2, and platelet-derived growth factor receptors alpha and beta in mutants indicated differences in cell proliferation, differentiation, and inflammation. Thus, we report that OSE changes occur long before epithelial tumors appear in FORKO mice. Our results suggest that neither incessant ovulation nor follicle-stimulating hormone receptor presence in the OSE is required for inducing ovarian tumors; thus, other mechanisms must contribute to ovarian tumorigenesis.

Alterations of folliculogenesis in women with polycystic ovary syndrome

“…It is important to point out that the lack of negative feedback on LH secretion mediated by estradiol and progesterone is considered the principal reason for the high serum LH concentrations in women with PCOS [26]. As previously described in ovarian epithelial [17], theca [15] and luteal cells [43] our data demonstrate for the first time that GATA-4 and GATA-6 are expressed in preovulatory follicles from both control and PCOS women. However, the fact that the mRNA abundances for both transcription factors in PCOS follicles were similar to those in controls led us to conclude that neither GATA-4 nor GATA-6 are responsible for the altered gene expressions of the steroidogenic enzymes found in PCOS patients.…”

“…Although it has been well established that GATA factors are expressed in ovarian tissue, their functions remain CAGCGCCTCAACAGCCACAT AAGGGCTTCTCCACGATGATGC [40] controversial. For example, it has been reported that the lack or diminution of the GATA system results in cellular dedifferentiation and ovarian tumorigenesis [16,17], whereas it has also been reported that GATA-4 is over-expressed in gonadal tumors [9]. Prostaglandins (PGs) play a fundamental role in the reproductive system [18][19][20].…”

FSH–FSHR3–stem cells in ovary surface epithelium: basis for adult ovarian biology, failure, aging, and cancer

“…Furthermore, these mice being sterile never ovulate and thus the concept of incessant ovulation does not explain the origin of ovarian cancer in these mice. Similarly, Chen et al (2007) questioned the very basis for incessant ovulation to result in ovarian cancer as more than 90% of FORKO mice develop ovarian epithelial tumors by 12 months of age, which are otherwise sterile and never ovulate . Smith & Xu (2008) have postulated that depletion of follicles and germ cells might underlie the etiology of ovarian cancers.…”

Anti-proliferative and pro-apoptotic actions of a novel human and mouse ovarian tumor-associated gene OTAG-12: downregulation, alternative splicing and drug sensitization

“…As knowledge of early tumorigenic events and genes is urgently needed, these issues can be studied systematically in models that can be experimentally manipulated to capture chronological changes. Thus we reported that in follitropin receptor knockout (FORKO) mice with sex hormone imbalances, females develop age-dependent ovarian tumors by B12 months (Danilovich et al, 2001;Chen et al, 2007). Tracking early and progressive ovarian tumorigenic events in this model revealed the pattern of molecular changes also found in EOC in women, including claudins, E-cadherin and platelet-derived growth factor (PDGF) ligands and receptors, as well as immune system upregulation in pretumor stages (Chen et al, 2006;Aravindakshan et al, 2006a, b).…”