Effect of acute ozone exposure on the lung metabolomes of obese and lean mice

Mathews, Joel; Kasahara, David I.; Cho, Youngji; Bell, Lauren N.; Karoly, Edward D.; Shore, Stephanie A.

doi:10.1371/journal.pone.0181017

Cited by 14 publications

(20 citation statements)

References 68 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Caspase-1 is activated upon assembly of the nucleotide oligomerization domain–like receptor protein 3 (NLRP3) inflammasome which can be activated, via toll-like receptor 4 (TLR4) by fatty acids. Increased circulating concentrations of lipids are common in obese subjects (89) and also increase after a high-fat meal (90) and increased lung concentrations of fatty acids are also observed in obese mice (91). Moreover, increased sputum concentrations of IL-1β and increased NLRP3 and TLR4 expression in sputum cells are observed in obese versus non obese asthmatic adults (90, 92).…”

Section: Mechanistic Basis For the Role Of Obesity In Severe Asthmamentioning

confidence: 99%

Obesity and severe asthma

Tashiro

Shore

2019

Allergology International

105

View full text Add to dashboard Cite

Obesity is an important global health issue for both children and adults. Obesity increases the prevalence and incidence of asthma and also increases the risk for severe asthma. Here we describe the features of severe asthma phenotypes for which obesity is a defining characteristic, including steroid resistance, airway inflammation, and co-morbidities. We also review current concepts regarding the mechanistic basis for the impact of obesity in severe asthma, including possible roles for vitamin D deficiency, systemic inflammation, and the microbiome. Finally, we describe data indicating a role for diet, weight loss, and exercise in the treatment of severe asthma with obesity. Better understanding of the mechanistic basis for the role of obesity in severe asthma could lead to new therapeutic options for this population.

show abstract

Section: Mechanistic Basis For the Role Of Obesity In Severe Asthmamentioning

confidence: 99%

Obesity and severe asthma

Tashiro

Shore

2019

Allergology International

105

View full text Add to dashboard Cite

show abstract

“…Women diagnosed with polycystic ovary syndrome, a hyperandrogenic disease, have less circulating glutathione and more malondialdehyde, a marker of oxidative stress than control women matched for body mass index (Sabuncu et al, ; Murri et al, ). Because O 3 exposure promotes oxidative stress within the lungs (Sunil et al, ; Wiegman et al, ; Mathews et al, ), we considered the possibility that androgens act to augment O 3 ‐induced AHR by increasing oxidative stress. To address this possibility, we measured protein carbonyls, a marker of O 3 ‐induced oxidative stress (Cho et al, ), in lung tissue.…”

Section: Resultsmentioning

confidence: 99%

“…The absence of any O 3 ‐induced increase in protein carbonyls in the sham mice is likely the result of the timing of tissue harvest, since increases in protein carbonyls peak approximately 3 h after cessation of exposure and resolve towards baseline by 24 h (Cho et al, ), the time point we assessed. We also measured lung mRNA expression of Gsta1 , an antioxidant enzyme involved in glutathione conjugation and detoxification that is induced by O 3 exposure (Mathews et al, ). Gsta1 mRNA abundance was significantly greater in O 3 ‐ versus air‐exposed mice, whether the mice were castrated or sham‐castrated, but the magnitude of this increase was significantly lower in the castrated than the sham‐castrated mice (Fig.…”

Section: Resultsmentioning

confidence: 99%

“…Lung RNA was purified using a commercial kit (RNeasy Mini Kit; Qiagen) and converted into cDNA (SuperScript III; Invitrogen, Carlsbad, CA). Lung gene expression was assessed using RT‐PCR (7300 Real‐Time PCR Systems; Applied Biosystems, Foster City, CA) with SYBR‐green detection and normalized to 36B4 ribosomal RNA, forward primer GCTCCAAGCAGA TGCAGCA, reverse primer, CCGGATGTGAGGCAGCAG (Mathews et al, ) using the ΔΔ Ct method. The primers for FK506‐binding protein 51 are as follows: forward primer ACTGTGTACTTCAAGGGAGGC, reverse primer, TTCTCTGACAGGCCGTATTCC.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Androgens augment pulmonary responses to ozone in mice

et al. 2019

Self Cite

View full text Add to dashboard Cite

Ozone causes airway hyperresponsiveness, a defining feature of asthma, and is an asthma trigger. In mice, ozone‐induced airway hyperresponsiveness is greater in males than in females, suggesting a role for sex hormones in the response to ozone. To examine the role of androgens in these sex differences, we castrated 4‐week‐old mice. Controls underwent sham surgery. At 8 weeks of age, mice were exposed to ozone (2ppm, 3 h) or room air. Twenty‐four hours later, mice were anesthetized and measurements of airway responsiveness to inhaled aerosolized methacholine were made. Mice were then euthanized and bronchoalveolar lavage was performed. Castration attenuated ozone‐induced airway hyperresponsiveness and reduced bronchoalveolar lavage cells. In intact males, flutamide, an androgen receptor inhibitor, had similar effects to castration. Bronchoalveolar lavage concentrations of several cytokines were reduced by either castration or flutamide treatment, but only IL‐1α was reduced by both castration and flutamide. Furthermore, an anti‐IL‐1α antibody reduced bronchoalveolar lavage neutrophils in intact males, although it did not alter ozone‐induced airway hyperresponsiveness. Our data indicate that androgens augment pulmonary responses to ozone and that IL‐1α may contribute to the effects of androgens on ozone‐induced cellular inflammation but not airway hyperresponsiveness.

show abstract

“…Importantly, these systemic effects of O 3 appear to contribute to O 3 -induced injury and inflammation within the lungs [24]. We have established that in mice, O 3 also impacts the lung metabolome [25], leading to changes in glutathione metabolism, phospholipid metabolism, and changes in the metabolism of BCAAs.…”

Section: Introductionmentioning

confidence: 99%

Ozone-induced changes in the serum metabolome: Role of the microbiome

et al. 2019

Self Cite

View full text Add to dashboard Cite

Ozone is an asthma trigger. In mice, the gut microbiome contributes to ozone-induced airway hyperresponsiveness, a defining feature of asthma, but the mechanistic basis for the role of the gut microbiome has not been established. Gut bacteria can affect the function of distal organs by generating metabolites that enter the blood and circulate systemically. We hypothesized that global metabolomic profiling of serum collected from ozone exposed mice could be used to identify metabolites contributing to the role of the microbiome in ozone-induced airway hyperresponsiveness. Mice were treated for two weeks with a cocktail of antibiotics (ampicillin, neomycin, metronidazole, and vancomycin) in the drinking water or with control water and then exposed to air or ozone (2 ppm for 3 hours). Twenty four hours later, blood was harvested and serum analyzed via liquid-chromatography or gas-chromatography coupled to mass spectrometry. Antibiotic treatment significantly affected 228 of the 562 biochemicals identified, including reductions in the known bacterially-derived metabolites, equol, indole propionate, 3-indoxyl sulfate, and 3-(4-hydroxyphenyl)propionate, confirming the efficacy of the antibiotic treatment. Ozone exposure caused significant changes in 334 metabolites. Importantly, ozone-induced changes in many of these metabolites were different in control and antibiotic-treated mice. For example, most medium and long chain fatty acids declined by 20–50% with ozone exposure in antibiotic-treated but not control mice. Most taurine-conjugated bile acids increased with ozone exposure in antibiotic-treated but not control mice. Ozone also caused marked (9-fold and 5-fold) increases in the polyamines, spermine and spermidine, respectively, in control but not antibiotic-treated mice. Each of these metabolites has the capacity to alter airway responsiveness and may account for the role of the microbiome in pulmonary responses to ozone.

show abstract

Effect of acute ozone exposure on the lung metabolomes of obese and lean mice

Cited by 14 publications

References 68 publications

Obesity and severe asthma

Obesity and severe asthma

Androgens augment pulmonary responses to ozone in mice

Ozone-induced changes in the serum metabolome: Role of the microbiome

Contact Info

Product

Resources

About