Effect of Rho-kinase Inhibitor, Y27632, on Porcine Corneal Endothelial Cell Culture, Inflammation and Immune Regulation

Abstract

Purpose To investigate the effect of the Rho-kinase inhibitor, Y27632, on pig corneal endothelial cell (pCEC) culture, and on inflammation and immune regulation of the responses of human cells to pCECs. Methods pCECs were cultured with/without Y27632 to assess cell proliferation and in vitro wound healing assay. The level of MCP-1 and VEGF in pCECs stimulated with human TNF-α were measured. Proliferation of human PBMCs stimulated with pCECs, and cytokine production in human T cells, and monocyte migration after stimulation were investigated. Results Y27632 promoted pCEC proliferation, prevented pCEC death, and enhanced in vitro wound healing. After stimulation, there were significantly lower levels of MCP-1 and VEGF measured in pCECs cultured with Y27632, and significantly reduced human PBMC proliferation, cytokine production, and monocyte migration. Conclusions The application of the Rho-kinase inhibitor will be beneficial when culturing pCECs, and may provide a novel therapy to reduce inflammation after corneal xenotransplantation.

Is interleukin-6 receptor blockade (tocilizumab) beneficial or detrimental to pig-to-baboon organ xenotransplantation?

“…Relative gene expression values were presented as 2 −ΔΔCT . All primers were purchased from Invitrogen, and sequences have been reported . For example, the sequence of fibroblast growth factor (FGF2) was TGCAAAAACGGAGGCTTCTTC (sense) and GTTGTAGTTTGATGTGAGGGTCG (antisense).…”

“…22 All primers were purchased from Invitrogen, and sequences have been reported. 16,23 For example, the sequence of fibroblast growth factor (FGF2) was TGCAAAAACGGAGGCTTCTTC (sense) and GTTGTAGTTTGATGTGAGGGTCG (antisense). The qPCR conditions included 95°C for 2 minutes, 50°C for 2 minutes, followed by 40 cycles at 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 1 minute.…”

ROCK Inhibition as Potential Target for Treatment of Pulmonary Hypertension

“…The inhibition of ROCK impairs the adhesion of peripheral blood monocytes to endothelial cells [ 124 ], and reduces their migration, proliferation and differentiation [ 113 , 129 , 130 ], reflecting the relevance of the enzyme to mononuclear cell infiltration in PH lungs [ 131 , 132 ]. The activation of ROCK also mediates macrophage biomechanical functions with the maintenance of cell shape and the stimulation of amoeboid migration [ 113 , 133 , 134 , 135 ].…”

A p-Tyr42 RhoA Inhibitor Promotes the Regeneration of Human Corneal Endothelial Cells by Ameliorating Cellular Senescence

“…In this study, we reveal that MH4, a p-Tyr42 RhoA inhibitor, promotes the regeneration of hCECs. ROCK inhibitors, such as Y27632 and fasudil, promote the proliferation of hCECs [ 58 , 60 , 61 ] by facilitating the degradation of p27Kip1 (p27), promoting the cyclin D levels [ 61 ], and inducing the loss of actin stress fibers and cell–cell tight junctions [ 58 ]. The shape of CECs is restored after treating with ROCK inhibitors [ 58 ].…”