Efficacy of glycogen synthase kinase-3β targeting against osteosarcoma via activation of β-catenin

Abstract

Development of innovative more effective therapy is required for refractory osteosarcoma patients. We previously established that glycogen synthase kinase-3β (GSK- 3β) is a therapeutic target in various cancer types. In the present study, we explored the therapeutic efficacy of GSK-3β inhibition against osteosarcoma and the underlying molecular mechanisms in an orthotopic mouse model. Expression and phosphorylation of GSK-3β in osteosarcoma and normal osteoblast cell lines was examined, together with efficacy of GSK-3β inhibition on cell survival, proliferation and apoptosis and on the growth of orthotopically-transplanted human osteosarcoma in nude mice. We also investigated changes in expression, phosphorylation and co-transcriptional activity of β-catenin in osteosarcoma cells following GSK-3β inhibition. Expression of the active form of GSK- 3β (tyrosine 216-phosphorylated) was higher in osteosarcoma than osteoblast cells. Inhibition of GSK-3β activity by pharmacological inhibitors or of its expression by RNA interference suppressed proliferation of osteosarcoma cells and induced apoptosis. Treatment with GSK-3β-specific inhibitors attenuated the growth of orthotopic osteosaroma in mice. Inhibition of GSK-3β reduced phosphorylation at GSK- 3β-phospho-acceptor sites in β-catenin and increased β-catenin expression, nuclear localization and co-transcriptional activity. These results suggest the efficacy of GSK-3β inhibitors is associated with activation of β-catenin, a putative tumor suppressor in bone and soft tissue sarcoma and an important component of osteogenesis. Our study thereby demonstrates a critical role for GSK-3β in sustaining survival and proliferation of osteosarcoma cells, and identifies this kinase as a potential therapeutic target against osteosarcoma.

Glycogen synthase kinase 3β as a potential therapeutic target in synovial sarcoma and fibrosarcoma

“…To examine the effects of GSK3β expression on cell survival and apoptosis, we used siRNA specific to human GSK3β (5′‐GCUCCAGAUCAUGAGAAAGCUAGAU‐3′; GSK‐3β Validated Stealth RNAi) and negative control siRNA (Stealth RNAi Negative Control Low GC duplex), both from Invitrogen. We previously confirmed the specificity of GSK3β‐specific siRNA . Effect of siRNA on GSK3β expression was monitored by western blotting with an antibody that recognizes both GSK3α and GSK3β (Table ).…”

“…Cells suspended in Matrigel (BD Bioscience) (1 × 10 6 cells/100 μL) were injected s.c. Mice assigned to three groups (4 mice each) were given i.p. injections of 75% DMSO or either of the GSK3β inhibitors (2 mg/kg body weight), three times a week for 3 weeks (Figure ) as we described previously . Assuming that 60% of body weight is accounted by body fluid, a dose of 2 mg/kg body weight corresponds to a concentration of approximately 10 μmol/L in culture media for both inhibitors .…”

“…Cellular protein was extracted using a cell lysis buffer (CelLytic‐MT; Sigma‐Aldrich). A 30‐μg aliquot of protein extract was analyzed by western blotting for the proteins of interest as described previously . Total amount of protein in each sample was monitored by the expression of β‐actin.…”

“…Representative paraffin sections of tumors from sarcoma patients (Table ) were examined for the expression and phosphorylation of GSK3β and for subcellular localization of β‐catenin by the ABC method as per our previous study using antibodies to GSK3β, its fractions phosphorylated in serine (S)9 (pGSK3β S9 ) and tyrosine (Y)216 residue (pGSK3β Y216 ), and β‐catenin (Table ). Expression and subcellular localization of β‐catenin were examined in the sarcoma cell lines by immunofluorescence staining with an antibody shown in Table , as described previously …”

“…Our observations and other studies establish GSK3β as a common and attractive therapeutic target for a broad spectrum of chronic diseases including cancer . A therapeutic effect from GSK3β inhibition has been shown not only in epithelial but also in hematopoietic, neuronal and musculoskeletal malignancies, including rhabdomyosarcoma and osteosarcoma . Here we explore the expression, activity and putative pathological role of GSK3β in the two major types of orthopedic STSs: synovial sarcoma and fibrosarcoma …”