Emerging Family of Proline-Specific Peptidases of
            <i>Porphyromonas gingivalis</i>
            : Purification and Characterization of Serine Dipeptidyl Peptidase, a Structural and Functional Homologue of Mammalian Prolyl Dipeptidyl Peptidase IV

Bańbuła, Agnieszka; Bugno, Marcin; Goldstein, Jason; Yen, Jane; Nelson, Daniel; Travis, James; Potempa, Jan

doi:10.1128/iai.68.3.1176-1182.2000

Cited by 62 publications

(70 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1). In accord with a previous report [14], recombinant DPPIV most preferentially hydrolyzed Gly-Pro-MCA, while that of Lys-Ala-MCA was less potent.…”

Section: Peptidase Activities Of Dpps Belonging To Clusters 1-5 From supporting

confidence: 92%

Discrimination based on Gly and Arg/Ser at position 673 between dipeptidyl-peptidase (DPP) 7 and DPP11, widely distributed DPPs in pathogenic and environmental gram-negative bacteria

et al. 2013

View full text Add to dashboard Cite

Porphyromonas gingivalis, an asaccharolytic gram-negative rod-shaped bacterium, expresses the novel Asp/Glu-specific dipeptidyl-peptidase (DPP) 11 (Ohara-Nemoto, Y. et al., (2011) J. Biol. Chem. 286, 38115-38127), which has been categorized as a member of the S46/DPP7 family that is preferential for hydrophobic residues at the P1 position. From that finding, 129 gene products constituting five clusters from the phylum Bacteroidetes have been newly annotated to either DPP7 or DPP11, whereas the remaining 135 members, mainly from the largest phylum Proteobacteria, have yet to be assigned. In this study, the substrate specificities of the five clusters and an unassigned group were determined with recombinant DPPs from typical species, i.e., P. gingivalis, Capnocytophaga gingivalis, Flavobacterium psychrophilum, Bacteroides fragilis, Bacteroides vulgatus, and Shewanella putrefaciens.Consequently, clusters 1, 3, and 5 were found to be DPP7 with rather broad substrate specificity, and clusters 2 and 4 were DPP11. An unassigned S. putrefaciens DPP carrying Ser 673 exhibited Asp/Glu-specificity more preferable to Glu, in contrast to the Asp preference of DPP11 with Arg 673 from Bacteroidetes species. Mutagenesis experiments revealed that Arg 673 /Ser 673 were indispensable for the Asp/Glu-specificity of DPP11, and that the broad specificity of DPP7 was mediated by Gly 673 . Taken together with the distribution of the two genes, all 264 members of the S46 family could be attributed to either DPP7 or DPP11 by an amino acid at position 673. A more compelling phylogenic tree based on the conserved C-terminal region suggested two gene duplication events in the phylum Bacteroidetes, one causing the development of DPP7 and DPP11 with altered substrate specificities, and the other producing an additional DPP7 in the genus Bacteroides.

show abstract

“…1). In accord with a previous report [14], recombinant DPPIV most preferentially hydrolyzed Gly-Pro-MCA, while that of Lys-Ala-MCA was less potent.…”

Section: Peptidase Activities Of Dpps Belonging To Clusters 1-5 From supporting

confidence: 92%

Discrimination based on Gly and Arg/Ser at position 673 between dipeptidyl-peptidase (DPP) 7 and DPP11, widely distributed DPPs in pathogenic and environmental gram-negative bacteria

et al. 2013

View full text Add to dashboard Cite

show abstract

“…Together with the present and previous observations of PgDPP4, including the kinetic parameters of enzymatic reactions, optimal pH, inhibitor profiles, and substrate preference for Pro and less for Ala (15,18,31), our results led us to conclude that the enzymatic properties of bacterial DPP4 substantially resemble those of the human entity (28,38). In fact, the present findings revealed release of the N-terminal dipeptide from the incretin peptides GLP-1 and GIP by bacterial DPP4.…”

Section: Discussionsupporting

confidence: 53%

“…Furthermore, similar masses between recombinant and native DPP4 suggested that major posttranslational modifications did not occur in bacterial entities. Indistinguishable activities between native and recombinant PgDPP4s were reported previously (18,32). In addition, molecular masses of recombinant and native forms of DPP4 were estimated as approximately 9% smaller than those of the deduced sequences.…”

Section: Resultsmentioning

confidence: 71%

“…Genomic DNA from T. forsythia and P. intermedia was prepared as previously reported (54). A DNA fragment encoding T. forsythia DPP4 (TfDPP4) Val 18 to Leu 722 was amplified by PCR using KOD-Plus-Neo DNA polymerase, genomic DNA as a template, and a set of primers (GTTGTCAGCGCTCAGCAGCGGGTGGA and GAGATTTTCCAGTACAAAATTCGTCA) which were designed based on the gene (KEGG entry, BFO_1659) assigned for S9A/B/C family peptidase in T. forsythia ATCC 43037. That for P. intermedia DPP4 (PiDPP4) Cys 8 to Lys 731 was amplified with a set of primers (CAAGCCGGATCCTGTGCAGCGTTATTAGCAACGTCTA and ATCTCTGGATCCCTTCAAGTTCTGAA CAAACCAATCG; BamHI sites are underlined) designed according to the sequence (GenBank accession no.…”

Section: Methodsmentioning

confidence: 99%

“…We recently identified novel dipeptide-producing exopeptidases in P. gingivalis, including DPP11, which specifically releases Xaa-Asp and Xaa-Glu (14); DPP5, with preference for the penultimate Ala and hydrophobic residues from the N terminus (15); and acylpeptidyl oligopeptidase (AOP), with preference mainly for the P1 position hydrophobic residue (16). Moreover, P. gingivalis expresses two additional DPPs and gingipains: DPP4 releases mainly Xaa-Pro but also Xaa-Ala and His-Ser (17,18), DPP7 preferentially cleaves dipeptides with both P1 and P2 hydrophobic residues (19,20), and Lys and Arg gingipains (Kgp and Rgp, respectively) exhibit Lysand Arg-specific dipeptidyl peptidase activities as well as endopeptidase activities (15). These peptidases are thought to cover most combinations of P2 and P1 amino acid residues and, therefore, efficiently produce N-terminal dipeptides from polypeptides (21).…”

mentioning

confidence: 99%

See 2 more Smart Citations

Degradation of Incretins and Modulation of Blood Glucose Levels by Periodontopathic Bacterial Dipeptidyl Peptidase 4

et al. 2017

View full text Add to dashboard Cite

Severe periodontitis is known to aggravate diabetes mellitus, though molecular events related to that link have not been fully elucidated. Porphyromonas gingivalis, a major pathogen of periodontitis, expresses dipeptidyl peptidase 4 (DPP4), which is involved in regulation of blood glucose levels by cleaving incretins in humans. We examined the enzymatic characteristics of DPP4 from P. gingivalis as well as two other periodontopathic bacteria, Tannerella forsythia and Prevotella intermedia, and determined whether it is capable of regulating blood glucose levels. Cellassociated DPP4 activity was found in those microorganisms, which was effectively suppressed by inhibitors of human DPP4, and molecules sized 73 kDa in P. gingivalis, and 71 kDa in T. forsythia and P. intermedia were immunologically detected. The k cat /K m values of recombinant DPP4s ranged from 721 Ϯ 55 to 1,283 Ϯ 23 M Ϫ1 s Ϫ1 toward Gly-Pro-4-methylcoumaryl-7-amide (MCA), while those were much lower for His-Ala-MCA. Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis showed His/Tyr-Ala dipeptide release from the N termini of incretins, glucagon-like peptide 1 (GLP-1) and glucose-dependent insulinotropic polypeptide, respectively, with the action of microbial DPP4. Moreover, intravenous injection of DPP4 into mice decreased plasma active GLP-1 and insulin levels, accompanied by a substantial elevation in blood glucose over the control after oral glucose administration. These results are the first to show that periodontopathic bacterial DPP4 is capable of modulating blood glucose levels the same as mammalian DPP4; thus, the incidence of periodontopathic bacteremia may exacerbate diabetes mellitus via molecular events of bacterial DPP4 activities.

show abstract

Peptidylarginine deiminase from Porphyromonas gingivalis citrullinates human fibrinogen and α‐enolase: Implications for autoimmunity in rheumatoid arthritis

Wegner¹,

Wait²,

Sroka³

et al. 2010

Arthritis & Rheumatism

Self Cite

576

487

View full text Add to dashboard Cite

Objective. To investigate protein citrullination by the periodontal pathogen Porphyromonas gingivalis as a potential mechanism for breaking tolerance to citrullinated proteins in rheumatoid arthritis (RA).Methods. The expression of endogenous citrullinated proteins was analyzed by immunoblotting of cell extracts from P gingivalis and 10 other oral bacteria. P gingivalis-knockout strains lacking the bacterial peptidylarginine deiminases (PADs) or gingipains were created to assess the role of these enzymes in citrullination. Citrullination of human fibrinogen and ␣-enolase by P gingivalis was studied by incubating live wild-type and knockout strains with the proteins and analyzing the products by immunoblotting and mass spectrometry.Results. Endogenous protein citrullination was abundant in P gingivalis but lacking in the other oral bacteria. Deletion of the bacterial PAD gene resulted in complete abrogation of protein citrullination. Inactivation of arginine gingipains, but not lysine gingipains, led to decreased citrullination. Incubation of wild-type P gingivalis with fibrinogen or ␣-enolase caused degradation of the proteins and citrullination of the resulting peptides at carboxy-terminal arginine residues, which were identified by mass spectrometry.Conclusion. Our findings demonstrate that among the oral bacterial pathogens tested, P gingivalis is unique in its ability to citrullinate proteins. We further show that P gingivalis rapidly generates citrullinated host peptides by proteolytic cleavage at Arg-X peptide bonds by arginine gingipains, followed by citrullination of carboxy-terminal arginines by bacterial PAD. Our results suggest a novel model where P gingivalismediated citrullination of bacterial and host proteins provides a molecular mechanism for generating antigens that drive the autoimmune response in RA.Rheumatoid arthritis (RA) is characterized by disease-specific autoimmunity to citrullinated proteins. Citrullination is a posttranslational modification of arginine residues that is mediated by the family of peptidylarginine deiminases (PADs). Citrullinated fibrin(ogen) and ␣-enolase are 2 of the physiologic proteins that are targeted by anti-citrullinated protein antibodies in RA (1-5). Fibrinogen is the precursor of fibrin, and autoanMs. Wegner and Drs.

show abstract

Emerging Family of Proline-Specific Peptidases of Porphyromonas gingivalis : Purification and Characterization of Serine Dipeptidyl Peptidase, a Structural and Functional Homologue of Mammalian Prolyl Dipeptidyl Peptidase IV

Cited by 62 publications

References 41 publications

Discrimination based on Gly and Arg/Ser at position 673 between dipeptidyl-peptidase (DPP) 7 and DPP11, widely distributed DPPs in pathogenic and environmental gram-negative bacteria

Discrimination based on Gly and Arg/Ser at position 673 between dipeptidyl-peptidase (DPP) 7 and DPP11, widely distributed DPPs in pathogenic and environmental gram-negative bacteria

Degradation of Incretins and Modulation of Blood Glucose Levels by Periodontopathic Bacterial Dipeptidyl Peptidase 4

Peptidylarginine deiminase from Porphyromonas gingivalis citrullinates human fibrinogen and α‐enolase: Implications for autoimmunity in rheumatoid arthritis

Contact Info

Product

Resources

About