En Passant Mutagenesis: A Two Step Markerless Red Recombination System

Abstract

Bacterial artificial chromosomes are used to maintain and modify large sequences of different origins in Escherichia coli. In addition to RecA-based shuttle mutagenesis, Red recombination is commonly used for sequence modification. Since foreign sequences, such as antibiotic resistance genes as well as frt- or loxP-sites are often unwanted in mutant BAC clones, we developed a Red-based technique that allows for the scarless generation of point mutations, deletions, and insertion of smaller and larger sequences. The method employs a sequence duplication that is inserted into the target sequence in the first recombination step and the excision of the selection marker by in vivo I-SceI cleavage and the second Red recombination. To allow for convenient and highly efficient mutagenesis without the use of additional plasmids, the E. coli strain GS1783 with a chromosomal encoded inducible Red- and I-SceI-expression was created.

Rhadinovirus vector-derived human telomerase reverse transcriptase expression in primary T cells

“…Red or RecET recombination systems provide novel means for in vivo recombineering and allow homologydependent recombination-mediated genetic engineering with large DNA molecules. By en passant mutagenesis, 39 a modified two-step red-recombination method, we were able to reconstitute the original viral sequence, yielding HVS BAC488. Thereafter, viral oncogene-deletion mutants were generated by the same method, which enabled the precise and efficient constitution of virus mutants.…”

“…25,37 The markerless release of the enhanced green fluorescent protein (EGFP) cassette and the reconstitution of the original virus sequence was achieved by en passant mutagenesis. 38,39 For constructing RT-hTERT BAC488, the expression cassette for hTERT was inserted into orf75 by homologous recombination. Dorf1RT-hTERT BAC488, the stpC/tipdeletion mutant of RT, was also generated by en passant mutagenesis (Supplementary Figure S1b).…”

“…39 Briefly, a transfer construct was generated by PCR amplification of the kanamycin resistance gene aphAI and the I-SceI homing endonuclease cleavage site of the pEPkanS2 vector 38 using the following polyacrylamide gel-purified primers that carry 50 bp genomic duplications flanking the EGFP cassette in EGFP-BAC488: 5 0 -CAAAA ATAAAACAACAGTTTGTATTAATTTATCTTACCACCAT TTTATTTAAATAAGCAGAGTAAGTATTTTTAGTAGGGA TAACAGGGTAATCGATTT-3 0 and 5 0 -GATTTGAATATTA CTTAAACTCCTACTAAAAATACTTACTCTGCTTATTT AAATAAAATGGTGGTAAGATAAATTGCCAGTGTTACA ACCAATTAACC-3 0 (Biomers, Ulm, Germany). Subsequently, the EGFP fragment was substituted by the aphAI and I-SceI site fragment by homologous recombination in the first red-recombination step.…”

Site-Directed Mutagenesis Using Oligonucleotide-Based Recombineering

“…In contrast, homologous regions flanking a DSB generated by I-SceI can also act as substrates for Red recombination. This strategy has been used for scarless site-directed mutagenesis of BACs (Tischer et al, 2010, Tischer et al, 2006 and the E. coli genome (Yu et al, 2008). These approaches require the integration of a duplicated sequence stretch in the first recombination round to serve as a substrate for recombination in the second round.…”

“…For the manipulation of BACs, a special E. coli host strain was developed to facilitate the independent expression of λ Red and I-SceI. E. coli GS1783 harbors within its genome λ Red under control of a temperature-sensitive repressor and I-SceI under control of an arabinose-inducible promoter (Tischer et al, 2010). However, for modification of bacterial genomes the components for recombination and I-SceI have to be provided on one or two plasmid(s).…”