EndB, a Multidomain Family 44 Cellulase from Ruminococcus flavefaciens 17, Binds to Cellulose via a Novel Cellulose-Binding Module and to Another R. flavefaciens Protein via a Dockerin Domain

Abstract

The mechanisms by which cellulolytic enzymes and enzyme complexes in Ruminococcus spp. bind to cellulose are not fully understood. The product of the newly isolated cellulase gene endB from Ruminococcus flavefaciens 17 was purified as a His-tagged product after expression in Escherichia coli and found to be able to bind directly to crystalline cellulose. The ability to bind cellulose is shown to be associated with a novel cellulose-binding module (CBM) located within a region of 200 amino acids that is unrelated to known protein sequences. EndB (808 amino acids) also contains a catalytic domain belonging to glycoside hydrolase family 44 and a C-terminal dockerin-like domain. Purified EndB is also shown to bind specifically via its dockerin domain to a polypeptide of ca. 130 kDa present among supernatant proteins from Avicel-grown R. flavefaciens that attach to cellulose. Cellulolytic Ruminococcus spp. play an important role in the degradation of plant cell wall polysaccharides in the rumen and hindgut of mammals (5,15,20). Early biochemical and microscopic evidence indicated that their plant cell wall-degrading enzymes are organized into high-molecular-weight complexes on the cell surface (22,24,43). Analysis of cloned polysaccharidase genes has, however, produced somewhat conflicting evidence concerning the molecular organization of these enzymes, and the mechanisms by which they might attach to their substrate and to the cell surface have thus remained unclear. Many of the cellulase genes first isolated from R. flavefaciens and R. albus (7,18,30,33,40,41) were reported to encode single domain enzymes smaller than 50 kDa that carry no obvious substrate binding domains, and no regions that might be responsible for the types of protein-protein interactions that are found, for example, in the assembly of cellulosome complexes from Clostridium spp. (3, 4, 9). On the other hand, it has been known for some time that xylanases from R. flavefaciens display complex multidomain organization (11, 45). Furthermore, the endoglucanase EndA from R. flavefaciens 17 was shown to be a multidomain enzyme carrying an 80-amino-acid dockerin-like region that is also present in three xylanases and an esterase from the same strain (2, 19). Dockerin-like regions have also been reported recently in multidomain endoglucanases from R. albus F40 (29, 30). Since dockerins are responsible for the assembly of cellulosome complexes via specific dockerin-cohesin interactions in Clostridium species (3,4,17,31,34), this provides a strong indication that complexes resembling cellulosomes may be involved in the organization of many plant cell wall-degrading enzymes in ruminococci. In support of this, two linked genes that encode structural proteins containing cohesin domains have recently been identified in R. flavefaciens 17 (8). Cellulosome organization provides one potential mechanism for binding of cellulolytic enzymes to their substrate since cellulosomal scaffolding proteins from clostridia carry cellulose-binding modules (CBMs) (4, 39). On t...

Unconventional Mode of Attachment of the Ruminococcus flavefaciens Cellulosome to the Cell Surface

“…flavefaciens strain 17 produces a cellulosome complex that is known to involve the cohesin-containing structural components ScaA, ScaB, and ScaC, together with interacting enzymes and unidentified proteins that carry dockerin domains (1,(36)(37)(38). The assembly of the different components in the R. flavefaciens cellulosome differs from the proposed molecular architecture in the clostridial cellulosomes.…”

“…The cohesin-dockerin interaction was assessed in microtiter plates by affinity analysis using matching fusion-proteins systems (2). For this purpose, XynDoc fusion proteins, consisting of a His 6 -tagged Geobacillus stearothermophilus xylanase T-6 cloned upstream of the desired dockerin domain, i.e., derived from Rf Cel44A (previously known as EndB) (38), ScaA (36), or the C-terminal domain of ScaB (13), were produced by using the appropriate plasmid cassette (pETXynDoc) with CGCTGGTACC TGCTAACTACG-ATCACTCCTAC and GGACAGATCTTATTTACCGAAT CTTGCGTC as the respective forward and reverse primers. The complementary CBM-Coh fusion protein, comprising the family-3 CBM from the C. thermocellum scaffoldin CipA upstream of the ScaE cohesin, was prepared likewise by using pETCBMCoh, with GCTAGGATCCGGTCAG-GCTTATGATGC and GGCCGCTCGAGTTAAGATG-TAGTACTCTC as forward and reverse primers, respectively.…”

“…The assembly of the different components in the R. flavefaciens cellulosome differs from the proposed molecular architecture in the clostridial cellulosomes. In R. flavefaciens the primary (enzyme-incorporating) scaffolding protein ScaA is capable of binding a group of dockerin-containing enzymes to its three resident cohesin repeats (36,38). In addition, ScaC, a small dockerin-bearing protein that also possesses a single divergent cohesin domain, binds both to ScaA via its dockerin and to a range of thus-far-unidentified polypeptides via its cohesin.…”

ScaC, an Adaptor Protein Carrying a Novel Cohesin That Expands the Dockerin-Binding Repertoire of the Ruminococcus flavefaciens 17 Cellulosome

“…carried out in the same way as the Western blotting analysis on a nylon membrane spotted with 1 l of His 6 -tagged recombinant proteins that were previously purified (14,28,29) and probed either with an HRP-conjugated S-protein (Novagen) or biotinylated His 6 -tagged ScaC-Coh. Sample preparation for two-dimensional (2D) gel electrophoresis.…”

“…This bacterium produces a complex in which many plant cell wall-degrading enzymes are attached to a structural protein, ScaA, via specific dockerin interactions with the three conserved cohesin repeats of ScaA (28). ScaA, however, lacks an identifiable cellulose-binding module (CBM), although a CBM was identified in the cellulase EndB (29). In addition, previous studies revealed at least two distinct classes of dockerins among enzymes from R. flavefaciens 17 (1), and only one of these groups of dockerins, found in the EndB, EndA, XynB, and XynD enzymes, interacts with ScaA (28).…”