Enhanced immunotherapeutic effect of modified HPV16 E7-pulsed dendritic cell vaccine by an adeno-shRNA-SOCS1 virus

Abstract

Cervical cancer is the second most common cause of cancer-related deaths among women worldwide. However, no efficient therapy exists against cervical cancer and current treatments have several disadvantages. One possible novel approach is to develop immune-based strategies using tumor antigen-loaded dendritic cells (DCs) for the induction of cellular antitumor immunity. In this study, we created a modified HPV16 E7, HPV16mE7, to reduce its transformation activity and to enhance its antigenicity. The siRNA delivery technique was used to silence the suppressor of cytokine signaling 1 (SOCS1) gene in DCs. BM-derived DCs infected by ad-shRNA-SOCS1 were pulsed with the HPV16mE7 protein and then were transfused into mouse models bearing TC-1 tumor cells expressing HPV16 E6/E7. IFN-γ, cytokine (TNF-α, IL-12, IL-6) expression, anti-E7 antibody and cytotoxic T lymphocyte (CTL) levels were measured. The survival rate, survival days and the tumor volume of the mouse models from the different treatment groups were monitored. The data showed that the mE7-pulsed DC vaccine enhanced by adenovirus-mediated SOCS1 silencing exhibited better immunotherapeutic effect on the allografted tumor mouse models. The method by silencing SOCS1 in HPV16mE7 protein-pulsed DCs may provide a new strategy for the development of safe and effective immunotherapy for cervical cancer.

High expression of octamer transcription factor 1 in cervical cancer

“…Specific biomarkers are required for the early diagnosis and prediction of metastatic progression and effective therapy. However, there is currently no efficient therapy against cervical cancer and the available treatments have various disadvantages (1,16–21). It has been shown that inactivation of tumor suppressor genes and activation of oncogenes is significant in carcinogenesis, and results from genetic and epigenetic alterations (5,6).…”

Combining MPDL3280A with adoptive cell immunotherapy exerts better antitumor effects against cervical cancer

“…Furthermore, when SOCS1 was silenced, HPV16mE7-pulsed DCs showed enhanced efficacy against cervical cancer. 36 In this study, although the co-cultured DCCIKs hardly ever eradicate the tumor completely, it demonstrated moderate activity in inhibiting tumor growth and improved survival rate (30%) longer than 60 d in xenografted mice.…”

“…After 7 d of culture, >80 % of the cells expressed characteristic DC-specific markers demonstrated by flow cytometric analysis. Then, the DCs were exposed to Ad-shSOCS1 at 100 MOI for 8 h. The transducted cells were washed with PBS and pulsed with the HPVm16E7 protein at 25 mg/mL in fresh culture medium for 6 hrs (The recombinant adenovirus AdshSOCS1 and HPVm16E7 were prepared as we previously reported in 36 ), followed by stimulation with TNF-a (10 ng/mL) for 24 h to develop mature DCs. The finally matured DCs were co-cultured with CIKs at a ratio of 10:1 in CIK medium for 3 d to generate DCCIKs.…”

“…33 Silencing SOCS1 in DCs irritates the maturation of DCs and triggers an allogeneic T-cell expansion. [34][35][36] As activated (mature) and antigen-loaded DCs ex vivo cultured can induce the differentiation of antigen-specific T cells into effector T cells. Therefore, in this research, a modified HPV16 E7 (HPV16mE7) with reduced transformation activity and enhanced antigenicity was employed to load DCs with silenced SOCS1 mediated by Ad-shSOCS1.…”

The Immunotherapeutic Effect of SIRPα-Silenced DCs against Cervical Cancer

“…The interference fragment of (F) 5 ′ -GATCCCTACCTGAGTTCAG TGAAGGTGACTCAGCCTGAAGGAACTCAGGTAGTT TTTTG-3 ′ and (R) 5 ′ -AATTCAAAAAACTACCTGAGT TCCTTCAGGCTGAGTCACCTTCACTGAACTCAGGT AGG-3 ′ and the control interference fragment of (F) 5 ′ -GATCCTCACAACCTCCTAGAAAGAGTAGATTGTAC TACACAAAAGTACTATGTTTTTTG-3 ′ and (R) 5 ′ -AAT TCAAAAAACATAGTACTTTTGTGTAGTACAATCTAC TCTTTCTAGGAGGTTGTGAG were cloned into pShuttle-2 and then inserted into pAdeno-X vector [23][24][25][26]. The recombinant pAdeno-X vectors were verified by sequencing.…”