Enterococcus spp. from Azeitão and Nisa PDO-cheeses: Surveillance for antimicrobial drug resistance

Rocha, Patricia; Marques, Joana Monteiro; Barreto, António Salvador; Semedo-Lemsaddek, Teresa

doi:10.1016/j.lwt.2021.112622

Cited by 6 publications

(3 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Tetracycline resistance was found in 75% of E. faecalis and in 25% of E. faecium isolates. A similar result was found in enterococci recovered from Portuguese cheeses from Azeitão and Nisa (21 to 97%) [34]. In the present study, all tetracycline-resistant phenotypes were associated with the presence of the tetM gene.…”

Section: Discussionsupporting

confidence: 90%

“…For each cheese, two well-isolated and characteristic colonies were chosen from the chromogenic plates for biochemical (Gram staining, catalase, and oxidase tests) and molecular tests. For molecular identification, multiplex PCR with the primers Ent1 (TACTGA-CAAACCATTCATGATG) and Ent2 (AACTTCGTCACCAACGCGAAC) (112 bp) for Enterococcus spp., ddlE1 (ATCAAGTACAGTTAGTCTT) and ddlE2 (ACGATTCAAAGCTAACTG) (941 bp) for E. faecalis, and ddlF1 (GCAAGGCTTCTTAGAGA) and ddlF2 (CATCGTG-TAAGCTAACTTC) (550 bp) for E. faecium were performed as described by Rocha et al (2022) [34].…”

Section: Enterococcus Isolates From Cheesesmentioning

confidence: 99%

See 1 more Smart Citation

Multidrug Resistance in Enterococci Isolated from Cheese and Capable of Producing Benzalkonium Chloride-Resistant Biofilms

Salamandane,

Cahango,

Muetanene

et al. 2023

Biology

View full text Add to dashboard Cite

This study aimed to investigate enterococci recovered from eight Portuguese cheeses made with raw ewe’s milk, regarding antibiotic resistance, virulence genes, minimum inhibitory concentration (MIC) of benzalkonium chloride (BAC), biofilm formation capacity, and biofilm eradication (MBEC) by BAC. Antimicrobial resistance against seven antibiotics of five groups was evaluated using the disk diffusion method. The presence of the genes that encode resistance to the antibiotics penicillin (blaZ), erythromycin (ermA, ermB, and ermC), vancomycin (vanA and vanB), aminoglycoside (aac(6′)-Ie-aph(2″)-Ia), and β-lactam (pbp5) and the genes that encode virulence factors, frsB, cylA, gelE, esp, and agg, were investigated via multiplex PCR. The susceptibility of planktonic cells to BAC was evaluated by the MIC and MBC values of the isolates, using the broth microdilution method. To assess the biofilm-forming ability and resistance of biofilms to BAC, biofilms were produced on stainless steel coupons, followed by exposure to BAC. The results showed a high resistance to the antibiotics vancomycin (87.5%), erythromycin (75%), tetracycline (50%), and penicillin (37.5%). Multidrug resistance was observed in 68.8% of the isolates. Genes encoding the virulence factors FrsB (frsB) and gelatinase E (gelE) were detected in all isolates. The esp and cylA genes were found in 56.3% and 37.5% of the isolates, respectively. All isolates exhibited a biofilm-forming ability, regardless of incubation time and temperature tested. However, after 72 h at 37 °C, E. faecium and E. faecalis biofilms showed significant differences (p ≤ 0.05). Although most isolates (62.5%) were susceptible to BAC (MIC ≤ 10 mg/L), biofilms of the same isolates were, generally, resistant to the higher concentration of BAC (80 mg/mL) tested. This study using Enterococcus isolates from a ready-to-eat food, such as cheese, reveals the high percentages of vancomycin resistance and multidrug resistance, associated with the presence of virulence genes, in isolates also capable of producing biofilms resistant to BAC, an important active ingredient of many disinfectants. These results emphasize the need for effective control measures to ensure the safety and quality of dairy products.

show abstract

Section: Discussionsupporting

confidence: 90%

Section: Enterococcus Isolates From Cheesesmentioning

confidence: 99%

Multidrug Resistance in Enterococci Isolated from Cheese and Capable of Producing Benzalkonium Chloride-Resistant Biofilms

Salamandane,

Cahango,

Muetanene

et al. 2023

Biology

View full text Add to dashboard Cite

show abstract

“…The rise of AMR poses significant challenges to global health and food safety, to the extent that the WHO anticipates entry into the postantimicrobial era during the present century [138]. Numerous studies [139][140][141] addressed antimicrobial resistance patterns and virulence factors in food products. Regarding the dissemination of ARGs and virulence determinants, some authors [111,119] have found evidence of clinical antimicrobial-resistant Enterococcus disseminated across the food chain.…”

Section: Dissemination Of Genetic Traits Across One Health Sectorsmentioning

confidence: 99%

Dissemination of Enterococcal Genetic Lineages: A One Health Perspective

et al. 2023

View full text Add to dashboard Cite

Enterococcus spp. are commensals of the gastrointestinal tracts of humans and animals and colonize a variety of niches such as water, soil, and food. Over the last three decades, enterococci have evolved as opportunistic pathogens, being considered ESKAPE pathogens responsible for hospital-associated infections. Enterococci’s ubiquitous nature, excellent adaptative capacity, and ability to acquire virulence and resistance genes make them excellent sentinel proxies for assessing the presence/spread of pathogenic and virulent clones and hazardous determinants across settings of the human–animal–environment triad, allowing for a more comprehensive analysis of the One Health continuum. This review provides an overview of enterococcal fitness and pathogenic traits; the most common clonal complexes identified in clinical, veterinary, food, and environmental sources; as well as the dissemination of pathogenic genomic traits (virulome, resistome, and mobilome) found in high-risk clones worldwide, across the One Health continuum.

show abstract

Microbiological, morpho-textural, and volatile characterization of Portuguese Queijo de Nisa PDO cheese

Cardinali

Foligni

Ferrocino

et al. 2022

Food Research International

View full text Add to dashboard Cite

Enterococcus spp. from Azeitão and Nisa PDO-cheeses: Surveillance for antimicrobial drug resistance

Cited by 6 publications

References 51 publications

Multidrug Resistance in Enterococci Isolated from Cheese and Capable of Producing Benzalkonium Chloride-Resistant Biofilms

Multidrug Resistance in Enterococci Isolated from Cheese and Capable of Producing Benzalkonium Chloride-Resistant Biofilms

Dissemination of Enterococcal Genetic Lineages: A One Health Perspective

Microbiological, morpho-textural, and volatile characterization of Portuguese Queijo de Nisa PDO cheese

Contact Info

Product

Resources

About