Environmental DNA analysis shows high potential as a tool for estimating intraspecific genetic diversity in a wild fish population

Abstract

<jats:title>Abstract</jats:title><jats:p>Environmental DNA (eDNA) analysis has recently been used as a new tool for estimating intraspecific diversity. However, whether known haplotypes contained in a sample can be detected correctly using eDNA-based methods has been examined only by an aquarium experiment. Here, we tested whether the haplotypes of Ayu fish (<jats:italic>Plecoglossus altivelis altivelis</jats:italic>) detected in a capture survey could also be detected from an eDNA sample derived from the field that contained various haplotypes with low concentrations and foreign substances. A water sample and Ayu specimens collected from a river on the same day were analysed by eDNA analysis and Sanger sequencing, respectively. The 10 L water sample was divided into 20 filters for each of which 15 PCR replications were performed. After high-throughput sequencing, denoising was performed using two of the most widely used denoising packages, UNOISE3 and DADA2. Of the 42 haplotypes obtained from the Sanger sequencing of 96 specimens, 38 (UNOISE3) and 41 (DADA2) haplotypes were detected by eDNA analysis. When DADA2 was used, except for one haplotype, haplotypes owned by at least two specimens were detected from all the filter replications. This study showed that the eDNA analysis for evaluating intraspecific genetic diversity provides comparable results for large-scale capture-based conventional methods, suggesting that it could become a more efficient survey method for investigating intraspecific genetic diversity in the field.</jats:p>

Quantitative evaluation of intraspecific genetic diversity in a natural fish population using environmental DNA analysis

“…Approximately 367 base pairs (bp) of mitochondrial DNA segments, which corresponded to the first half of the D‐loop region, were amplified via PCR using primers PaaDlp_F1 (5'‐AATCGAACTCCCGCCCTTAAC‐3') and PaaDlp_R1 (5'‐GTTGTCCCTGACCCTATCATTCA‐3') by following the procedures described in Tsuji, Maruyama, et al. (2020), and then were sequenced by Sanger sequencing. The haplotypes obtained from these specimens are hereafter referred to as the “reference haplotype”.…”

“…Environmental DNA was extracted from the filter samples by combining a spin column (EZ‐10; Bio Basic) with DNeasy Blood and Tissue Kit following the procedures described in Tsuji, Maruyama, et al. (2020). At the final step, DNA was eluted using 100 µl of Buffer AE.…”

“…More recently, researchers have begun to apply eDNA analysis not only to the detection of species but also to the estimation of intraspecific genetic diversity in a population (Parsons, Everett, Dahlheim, & Park, 2018; Sigsgaard et al., 2016; Tsuji, Maruyama, et al., 2020; Tsuji, Miya, et al., 2020). In conventional methods such as the direct capture of specimens, accurate evaluations and quantifications of the genetic diversity in a population require the collection of an adequate number of samples (Parsons et al., 2018), which is often a money‐, time‐ and labour‐consuming task.…”

“…Thus, eDNA analysis appears promising for the estimation of intraspecific genetic diversity in a population. Indeed, previous studies have successfully detected multiple mitochondrial DNA (mtDNA) haplotypes of their target species (Parsons et al., 2018; Sigsgaard et al., 2016; Tsuji, Maruyama, et al., 2020; Tsuji, Miya, et al., 2020).…”

“…Therefore, to help solve the second issue, it may be possible to use eDNA quantity as an indicator of the number of individuals who own each haplotype. Indeed, several recent studies have reported positive correlations between sequence reads of each haplotype and the abundance of individuals who own that haplotype in a population (Sigsgaard et al., 2016; Tsuji, Maruyama, et al., 2020; Tsuji, Miya, et al., 2020). Although in general the number of eDNA sequence reads obtained by HTS does not necessarily correspond to the eDNA quantity in samples (partly due to sample‐specific PCR inhibition), several studies have proposed the “internal standard DNA” approach, which overcomes this problem (e.g., Smets et al., 2016; Ushio, 2019; Ushio et al., 2018).…”