Epigenetic Regulation in Early Childhood: A Miniaturized and Validated Method to Assess Histone Acetylation

Harb, Hani; Amarasekera, Manori; Ashley, Sarah; Tulic, Meri K.; Pfefferle, Petra Ina; Potaczek, Daniel P.; Martino, David; Kesper, Dörthe A.; Prescott, Susan L.; Renz, Harald

doi:10.1159/000442158

Cited by 33 publications

(38 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The advantage of the application of a positive control gene measurement is that the same ChIP samples are used to analyse both, target and control sequences, thus minimizing variation caused by sample handling. The normalization was done according to the following formula [33,34]: …”

Section: Methodsmentioning

confidence: 99%

The role of PKCζ in cord blood T-cell maturation towards Th1 cytokine profile and its epigenetic regulation by fish oil

et al. 2017

Self Cite

View full text Add to dashboard Cite

While immunodeficiency of immaturity of the neonate has been considered important as the basis for unusual susceptibility to infection, it has also been recognized that the ability to progress from an immature Th2 cytokine predominance to a Th1 profile has relevance in determining whether children will develop allergy, providing an opportunity for epigenetic regulation through environmental pressures. However, this notion remains relatively unexplored. Here, we present evidence that there are two major control points to explain the immunodeficiency in cord blood (CB) T-cells, a deficiency in interleukin (IL)-12 (IL-12) producing and IL-10 overproducing accessory cells, leading to a decreased interferon γ (IFNγ) synthesis and the other, an intrinsic defect in T-cell protein kinase C (PKC) ζ (PKCζ) expression. An important finding was that human CB T-cells rendered deficient in PKCζ, by shRNA knockdown, develop into low tumour necrosis factor α (TNFα) and IFNγ but increased IL-13 producing cells. Interestingly, we found that the increase in PKCζ levels in CB T-cells caused by prenatal supplementation with fish oil correlated with modifications of histone acetylation at the PKCζ gene (PRKCZ) promoter. The data demonstrate that PKCζ expression regulates the maturation of neonatal T-cells into specific functional phenotypes and that environmental influences may work via PKCζ to regulate these phenotypes and disease susceptibility.

show abstract

Section: Methodsmentioning

confidence: 99%

The role of PKCζ in cord blood T-cell maturation towards Th1 cytokine profile and its epigenetic regulation by fish oil

et al. 2017

Self Cite

View full text Add to dashboard Cite

show abstract

“…In addition to inhibitory surface markers, defective clonal expansion and function of effector CD8 + T cells in neonates is potentially linked to differences in chromatin architecture and histone modification . Neonatal CD8 + T cells have specific epigenetic programming, with adult CD8 + T cells having higher levels of open chromatin marks and less repressive marks, which contribute to differences in gene expression levels between neonates and adults .…”

Section: T‐cell Chromatin Architecturementioning

confidence: 99%

Dissecting the defects in the neonatal CD8+ T-cell response

Fike

Kumova

Carey

2019

Journal of Leukocyte Biology

View full text Add to dashboard Cite

The neonatal period presents a complex scenario where the threshold of reactivity toward colonizing microbiota, maternal antigens, autoantigens, and pathogens must be carefully moderated and balanced. CD8+ T cells are critical for the response against intracellular bacteria and viruses, but this immune compartment maintains altered function relative to adult counterparts because of the unique challenges which infants face. Here, we review our current understanding of the factors which may promote the attenuation and altered function of the neonatal CD8+ T‐cell response and potential avenues for future study. Specifically, we have focused on the neonatal CD8+ T‐cell ontogeny, memory formation, TCR structure and repertoire, TCR inhibitory receptors, and the clinical implications of altered neonatal CD8+ T‐cell function. Special emphasis has been placed on examining the response of preterm neonates relative to term neonates and adults.

show abstract

“…DNA‐protein interactions in isolated cells were cross‐linked in 1% formaldehyde for 10 min at room temperature. Subsequently, ChIP was performed, as described recently (Harb et al ), using antibodies against acetylated histone H3 (H3ac; Merck Millipore, Darmstadt, Germany) and acetylated histone H4 (H4ac; Merck Millipore). Immunoprecipitated and eluted DNA was purified with QIAquick columns (Qiagen, Hilden, Germany) and amplified by means of quantitative PCR using primers specific for the murine promoters of Bdnf (promoter1; Bdnf forward: 5′‐TTGGTCACGTAACTGGCT‐3′; Bdnf reverse: 5′‐TGGGGAACTTGTTGCTTT‐3′), interleukin (Il)2 ( Il2 forward: 5′‐TAAATAAGGCCATAGAATGG‐3′; Il2 reverse: 5′‐ GTTACATTAGCCCACACTTA‐3′), Il6 ( Il6 forward: 5′‐GACATGCCAAAGTGCTGAGTCACT‐3′; Il6 reverse: 5′‐AGACTCATGGGAAAATCCCACATT‐3′), tumor necrosis factor (Tnf)‐α promoter ( Tnf‐α forward: 5′‐TGGGTTTCAGTTCTCAGGGT‐3′; Tnf‐α reverse: 5′‐GGGTTTGGAAAGTTGGGGAC‐3′) and the housekeeping gene Rpl32 promoter ( Rpl32 forward: 5′‐TCATTTCTCAGGCACATCTT‐3′; Rpl32 reverse: 5′‐ACTCACCGTAAAACAGATGG‐3′), respectively.…”

Section: Methodsmentioning

confidence: 99%

“…Subsequently, ChIP was performed, as described recently (Harb et al 2015), using antibodies against acetylated histone H3 (H3ac; Merck Millipore, Darmstadt, Germany) and acetylated histone H4 (H4ac; Merck Millipore). Immunoprecipitated and eluted DNA was purified with QIAquick columns (Qiagen, Hilden, Germany) and amplified by means of quantitative PCR using primers specific for the murine promoters of…”

Section: Epigenetic Analysismentioning

confidence: 99%

Aberrant cognitive phenotypes and altered hippocampal BDNF expression related to epigenetic modifications in mice lacking the post‐synaptic scaffolding protein SHANK1: Implications for autism spectrum disorder

et al. 2017

Self Cite

View full text Add to dashboard Cite

Autism spectrum disorder (ASD) is a class of neurodevelopmental disorders characterized by persistent deficits in social communication/interaction, together with restricted/repetitive patterns of behavior. ASD is among the most heritable neuropsychiatric conditions, and while available evidence points to a complex set of genetic factors, the SHANK gene family has emerged as one of the most promising candidates. Here, we assessed ASD-related phenotypes with particular emphasis on social behavior and cognition in Shank1 mouse mutants in comparison to heterozygous and wildtype littermate controls across development in both sexes. While social approach behavior was evident in all experimental conditions and social recognition was only mildly affected by genotype, Shank1 null mutant mice were severely impaired in object recognition memory. This effect was particularly prominent in juveniles, not due to impairments in object discrimination, and replicated in independent mouse cohorts. At the neurobiological level, object recognition deficits were paralleled by increased brain-derived neurotrophic factor (BDNF) protein expression in the hippocampus of Shank1 mice; yet BDNF levels did not differ under baseline conditions. We therefore investigated changes in the epigenetic regulation of hippocampal BDNF expression and detected an enrichment of histone H3 acetylation at the Bdnf promoter1 in Shank1 mice, consistent with increased learning-associated BDNF. Together, our findings indicate that Shank1 deletions lead to an aberrant cognitive phenotype characterized by severe impairments in object recognition memory and increased hippocampal BDNF levels, possibly due to epigenetic modifications. This result supports the link between ASD and intellectual disability, and suggests epigenetic regulation as a potential therapeutic target.

show abstract

Epigenetic Regulation in Early Childhood: A Miniaturized and Validated Method to Assess Histone Acetylation

Cited by 33 publications

References 22 publications

The role of PKCζ in cord blood T-cell maturation towards Th1 cytokine profile and its epigenetic regulation by fish oil

The role of PKCζ in cord blood T-cell maturation towards Th1 cytokine profile and its epigenetic regulation by fish oil

Dissecting the defects in the neonatal CD8+ T-cell response

Aberrant cognitive phenotypes and altered hippocampal BDNF expression related to epigenetic modifications in mice lacking the post‐synaptic scaffolding protein SHANK1: Implications for autism spectrum disorder

Contact Info

Product

Resources

About