Epizootic Haemorrhagic Disease Virus Serotype 8 in Tunisia, 2021

Sghaier, Soufien; Sailleau, Corinne; Marcacci, Maurilia; Thabet, Sarah; Curini, Valentina; Hassine, Thameur Ben; Teodori, Liana; Portanti, Ottavio; Hammami, Salah; Jurisic, Lucija; Spedicato, Massimo; Postic, Lydie; Gazani, Ines; Osman, Raja Ben; Zientara, Stéphan; Bréard, Emmanuel; Calistri, Paolo; Richt, Jürgen A.; Holmes, Edward C.; Savini, Giovanni; Giallonardo, Francesca Di; Lorusso, Alessio

doi:10.20944/preprints202211.0195.v1

Cited by 12 publications

(3 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This represents the first evidence of EHD in the European Union (EU). This report follows our previous studies on EHDV-8 in Tunisian cattle in 2021 (8).…”

Section: Introductionsupporting

confidence: 87%

“…This virus has a direct Northern African origin. This event was reasonably predictable as for the current widespread distribution of the same virus in Tunisia and likely in neighboring countries (8), and in consideration of the previous incursions of multiple BTV strains to Southern Europe. At the time this report has been prepared, on November 18 2022, EHD has been notified also in Andalusia (Cadiz and Sevilla)-Spain.…”

Section: Discussionmentioning

confidence: 78%

“…Samples were collected from the described animals and tested for the presence of EHDV RNA (VetMAX ™ EHDV Kit rRT-PCREHDV; Thermo Scientific™ Waltham, MA, USA). A real time RT-PCR specific for the S2 of EHDV-8 TUN 2021 (rRT-PCR EHDV-8 ) was established (Portanti et al, manuscript in preparation) as the available test designed on the S2 of the EHDV-8 reference serotype (Australia, 1982) was not able to detect EHDV-8 TUN 2021 (8). Overall, nucleotide sequences of forward and reverse primers and probes are EHDV_Ser8varNEW_fwd AGAGATGAAGATCGCGAGGA (975-994); EHDV_Ser8varNEW_rev GAATCACACGCGCTCACTAA (1135-1159) and EHDV_Ser8varNEW_Probe FAM-ACGGATGAGATACGGAACATACGGGG-TAMRA (1066-1091), respectively.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

First Detection of Epizootic Haemorrhagic Disease virus in the European Union, Italy-2022

Lorusso

Cappai

Loi

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…This represents the first evidence of EHD in the European Union (EU). This report follows our previous studies on EHDV-8 in Tunisian cattle in 2021 (8).…”

Section: Introductionsupporting

confidence: 87%

Section: Discussionmentioning

confidence: 78%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

First Detection of Epizootic Haemorrhagic Disease virus in the European Union, Italy-2022

Lorusso

Cappai

Loi

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

The Molecular Epidemiology of Epizootic Hemorrhagic Disease Viruses Identified in Israel between 2015 and 2023

Golender,

Hoffmann

2024

Epidemiologia

View full text Add to dashboard Cite

Epizootic hemorrhagic disease (EHD) is an infectious, non-contagious viral disease seriously affecting cattle and some wild ruminants and has a worldwide distribution. All viruses can be subdivided into “Eastern” and “Western” topotypes according to geographic distribution via the phylogenetic analysis of internal genes. In Israel, during the last decade, three outbreaks were registered: caused by EHDV-6 in 2015, by EHDV-1 in 2016, and by EHDV-7 in 2020. Additionally, RNA of EHDV-8 was found in imported calves from Portugal in 2023. During the same period in other countries of the region, non-Israeli-like EHDV-6 and EHDV-8 were identified. Full genome sequencing, BLAST, and phylogenetic analyses of the locally and globally known EHDV genomes allowed us to presume the probable route and origin of these viruses detected in Israel. Thus, EHDV-6 has probably been circulating in the region for a long period when EHDV-1 and -8 appeared here for the last years, while their route of introduction into the new areas was probably natural; all of them belonged to the “Western” topotype. In contrast, EHDV-7 probably had the “Eastern”, anthropogenic origin. Data from the study can facilitate the evaluation of the appearance or reappearance of EHDVs in the Mediterranean area and enhance the planning of prevention measures.

show abstract

Epizootic Hemorrhagic Disease Virus: Current Knowledge and Emerging Perspectives

Jiménez-Cabello¹,

Utrilla-Trigo²,

Lorenzo³

et al. 2023

Microorganisms

View full text Add to dashboard Cite

Epizootic Hemorrhagic Disease (EHD) of ruminants is a viral pathology that has significant welfare, social, and economic implications. The causative agent, epizootic hemorrhagic disease virus (EHDV), belongs to the Orbivirus genus and leads to significant regional disease outbreaks among livestock and wildlife in North America, Asia, Africa, and Oceania, causing significant morbidity and mortality. During the past decade, this viral disease has become a real threat for countries of the Mediterranean basin, with the recent occurrence of several important outbreaks in livestock. Moreover, the European Union registered the first cases of EHDV ever detected within its territory. Competent vectors involved in viral transmission, Culicoides midges, are expanding its distribution, conceivably due to global climate change. Therefore, livestock and wild ruminants around the globe are at risk for this serious disease. This review provides an overview of current knowledge about EHDV, including changes of distribution and virulence, an examination of different animal models of disease, and a discussion about potential treatments to control the disease.

show abstract

Epizootic Haemorrhagic Disease Virus Serotype 8 in Tunisia, 2021

Cited by 12 publications

References 36 publications

First Detection of Epizootic Haemorrhagic Disease virus in the European Union, Italy-2022

First Detection of Epizootic Haemorrhagic Disease virus in the European Union, Italy-2022

The Molecular Epidemiology of Epizootic Hemorrhagic Disease Viruses Identified in Israel between 2015 and 2023

Epizootic Hemorrhagic Disease Virus: Current Knowledge and Emerging Perspectives

Contact Info

Product

Resources

About