Estradiol mediates relaxation of porcine lower esophageal sphincter

Long-Chain Fatty Acid Receptors Mediate Relaxation of the Porcine Lower Esophageal Sphincter

“…The porcine LES, which has similar structure to the human LES, was divided into clasp with LC and sling with GC muscle strips according to previously published procedures with minor modifications (Farré et al, 2007; Tsai et al, 2015, 2018). The porcine LES is often used as an animal model system to study esophageal motility and GERD in humans (Korn et al, 1997; Schopf et al, 1997).…”

“…The basal tone of the muscle strip was adjusted to be 1.0 g. After a 30 min equilibration period, 1 × 10 −6 M carbachol was added into the organ bath to check the contraction of the muscle strips, and then, the carbachol was washed out. When reaching another equilibration period, endothelin 1 (3 × 10 −7 M), which induced a long-duration muscle contraction (Tsai et al, 2018), was added to induce a contraction. Sequentially 1 × 10 −5 , 3 × 10 −5 , 1 × 10 −4 , and 3 × 10 −4 M GW9508, fasiglifam, TUG424, TUG891, or GSK137647 was added in a non-cumulative dose manner into the organ baths separately, and the relaxation responses of isolated sling or clasp strips were recorded.…”

“…The real-time PCR amplification reactions were carried out with an Applied Biosystems ® 7500 Real-Time PCR System (Applied Biosystems, MA, United States) using the QuantiFast SYBR Green PCR Master Mix (Thermo Fisher Scientific Inc, MA, United States) under the following programming: one cycle of 95°C for 5 min, 40 cycles of 95°C for 10 s, and 60°C for 45 s. The primer sequences were: (1) FFA1: forward primer – TGGGAGGCTACTGGCGGAAG and reverse primer – GCCACACATGTTGTCCCCCG; (2) FFA4: forward primer – GTGCTGGCTGTTCGCTGGAC and reverse primer – AAGGCGCACAATGCACACCA. The 2 −Δ Δ Ct method was used to analyze the relative changes in gene expression from real-time quantitative PCR studies (Chiang et al, 2010; Grassin-Delyle et al, 2013; Tsai et al, 2018).…”

“…Immunostaining with anti-FFA1 (polyclonal, GeneTex, CA, United States) and anti-FFA4 (polyclonal, GeneTex, CA, United States) antibodies were executed on the fully automated Bond-Max system (Leica Microsystems, Nussloch, Germany) according to previously described procedures with minor modifications (Tsai et al, 2015, 2018). Slides carrying tissue sections of porcine sling and clasp muscles, cut from paraffin-embedded, formalin-fixed sections, were dried for 30 min at 60°C.…”

Arecae pericarpium extract induces porcine lower-esophageal-sphincter contraction via muscarinic receptors

“…According to previously reported method, one end of the muscle strips was attached to an isometric transducer with surgical wire (FORT10g; Grass Technologies, RI, USA). The transducer was connected to an amplifier (Gould Instrument Systems, OH, USA), the signal obtained was then recorded by a computer recording system (BIOPAC Systems, CA, USA) [ 16 , 17 ]. The muscle’s basal tone was set to 1.0 g for this study.…”