Estrogen receptor-positive mammary tumorigenesis in TGFα transgenic mice progresses with progesterone receptor loss

Rose-Hellekant, Teresa A.; Schroeder, Matthew; Brockman, Jennifer L.; Zhdankin, Olga; Bolstad, Rolph M.; Chen, K. S.; Gould, Michael N.; Schuler, Linda A.; Sandgren, Eric P.

doi:10.1038/sj.onc.1210340

Cited by 22 publications

(26 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Expression levels of Esr1 , Pgr , Myc , Nop16 and the housekeeping gene Pum1 were determined using methods described previously. Primers for Esr1 , Pgr , and Pum1 have been published (Rose-Hellekant et al 2007). Primers used to detect Nop16 were forward AAAGCGTCTGAACCGGAATGCT and reverse ACCTCCATGGCCTTTACCTTCT.…”

Section: Methodsmentioning

confidence: 99%

Molecular characterizations of Nop16 in murine mammary tumors with varying levels of c-Myc

et al. 2011

View full text Add to dashboard Cite

NOP16, also known as HSPC111, has been identified as a MYC and estrogen regulated gene in in vitro studies, hence coexpression levels were strongly correlated. Importantly, high expression of NOP16 was associated with poor clinical outcome in breast cancer patients. However, coexpression of NOP16, MYC and estrogen receptor (ESR1) varied widely in tumors and cell lines suggesting that transcriptional regulation differed according to pathological environments. The goal of this study was to determine the expression patterns of Nop16, Myc and Esr1 in murine mammary tumors with disparate histopathological and molecular features. We hypothesized that tumor environments with relatively high Myc levels would have different coexpression patterns than tumor environments with relatively low Myc levels. We measured levels of Myc and Nop16 mRNA and protein in tumors from WAP-c-myc mice that were of high grade and metastasized frequently. In contrast, Myc and Nop16 mRNA and proteins levels were significantly lower in the less aggressive tumors that developed in NRL-TGFα mice. Tumors from both mouse lines express ESR1 protein and we found that Esr1 mRNA levels correlated positively with Myc levels in both models. However, Myc and Nop16 transcript levels correlated positively only in tumors from NRL-TGFα mice. We identified prominent NOP16 protein in nuclei and less prominent staining in the cytoplasm of luminal cells of ducts and lobules from normal mammary glands as well as in hyperplasias and tumors obtained from NRL-TGFα mice. This staining pattern was reversed in tumors from WAP-c-Myc mice as nuclear staining was faint or absent and cytoplasmic staining more pronounced. In summary, the regulation of expression and localization of NOP16 varies in tumor environments with high versus low MYC levels and demonstrate the importance of stratifying clinical breast cancers based on MYC levels.

show abstract

Section: Methodsmentioning

confidence: 99%

Molecular characterizations of Nop16 in murine mammary tumors with varying levels of c-Myc

et al. 2011

View full text Add to dashboard Cite

show abstract

“…19 Similar to the staining pattern in glands of female NRL-hPAP mice, hPAP was detectable in mammary epithelial cells throughout the ductal tree in males positive for the transgene ( Figure 1A), unlike nontransgenic littermates ( Figure 1B). …”

Section: Nrl Promoter Induces Expression In Male Mammary Epithelial Cmentioning

confidence: 67%

“…These end-stage lesions were similar to those found in glands of NRL-TGF-␣ and bitransgenic females (Table 1 and Figure 1C). 18,19 Glands from NRL-TGF-␣/PRL males also developed rare squamous adenocarcinomas ( Figure 1D), as well as preneoplastic lesions including mammary intraepithelial neoplasias (MIN, Figure 1E), adenosis lesions ( Figure 1F), and epithelial hyperplasias (not shown). Both bitransgenic lines demonstrated similar serum PRL levels compared to nontransgenic littermates.…”

Section: Prl and Tgf-␣ Cooperatively Induce Tumors In Male Micementioning

confidence: 99%

“…16,17 Transgenic virgin female mice that overexpress TGF-␣ under control of the NRL promoter develop mammary tumors and preneoplastic lesions. 18,19 Together, TGF-␣ and PRL potently cooperate; bitransgenic NRL-TGF-␣/PRL females develop mammary tumors similar to those found in NRL-TGF-␣ females with a greatly reduced latency and 100% incidence. 18 This hormone/growth factor interaction is also strongly oncogenic in the male.…”

mentioning

confidence: 99%

“…This novel model system offers important insight into PRL, ER-␣, and TGF-␣ interactions in the pathogenesis of this disease in males and suggests therapeutic targets that may enhance survival in male breast cancer. 18,19 were generated as described. All lines were maintained in the FVB/N strain background.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Prolactin Drives Estrogen Receptor-α-Dependent Ductal Expansion and Synergizes with Transforming Growth Factor-α to Induce Mammary Tumors in Males

Arendt

Schuler

2008

The American Journal of Pathology

View full text Add to dashboard Cite

Male breast cancer is rare and has been the focus of limited research. Although the etiology is unclear, conditions increasing circulating prolactin (PRL), as well as estrogen, increase the risk of tumorigenesis.We modeled exposure to elevated PRL in transgenic mice, using the mammary-selective, estrogen-insensitive promoter neu-related lipocalin (NRL), to drive PRL expression. Male NRL-PRL mice did not develop mammary tumors. However, in cooperation with the well-characterized oncogene transforming growth factor-␣ (TGF-␣), PRL induced mammary tumors in 100% of male bitransgenic mice. Similar to disease in human males, these tumors expressed variable levels of estrogen receptor-␣ (ER-␣) and androgen receptors. However, carcinogenesis was not responsive to testicular steroids because castration did not alter latency to tumor development or tumor ER-␣ expression. Interestingly, both NRL-TGF-␣/PRL and NRL-PRL males demonstrated increased ductal development, which occurred during puberty, similar to female mice. This outgrowth was diminished in NRL-PRL males treated with ICI 182,780, suggesting that PRL enhances ER-mediated growth. Treatment of MCF-7-derived cells with PRL increased phosphorylation of ER-␣ at residues implicated in unliganded ER-␣ activity. Together, these studies suggest that PRL expands the pool of cells susceptible to tumorigenesis, which is then facilitated by PRL and TGF-␣ cross talk. Activation of ER-␣ is one mechanism by which PRL may contribute to breast cancer and points to other therapeutic strategies for male patients. An estimated 1690 new cases of male breast cancer will be diagnosed in the United States, and 460 men will die as a result of the disease this year. 1 Because it is a rare disease, male breast cancer has been the focus of very limited research. Unlike breast cancer in women, the incidence in men is rising 1.1% annually, and men are more likely to have advanced disease and poorer survival compared to women. 2 Conditions that elevate the ratio of circulating estrogens and androgens and increase the risk for this disease include Klinefelter's syndrome, liver cirrhosis, estrogen therapy for prostate cancer, obesity, and testicular abnormalities. 3,4 Similar to the postmenopausal disease in women, 85 to 91% of male breast cancers are estrogen receptor-␣ (ER-␣)-positive and respond to tamoxifen therapy, although the survival advantage for ER-␣-positive tumors is not as evident in males as females. 5 Androgen receptor (AR) is also expressed in a significant number (39 to 80%) of tumors. 6,7 Hyperprolactinemia is also a significant risk factor. 3,8 At least one-third of a consecutive series of male breast cancer patients had elevated serum levels of prolactin (PRL), which also correlated with the size of the primary tumor. 9 Drug treatments associated with PRL elevation and prolactinomas are also significantly linked to increased breast cancer risk. 10 In a retrospective study, one in three men with breast cancer had detectable PRL receptor in their tumors. 11 To study the effect o...

show abstract

Mouse Models of Breast Cancer

Sakamoto

Schmidt

Wagner

2015

Methods in Molecular Biology

View full text Add to dashboard Cite

Breast cancer is the most common cause of cancer death in women worldwide. This malignancy is a complex disease, which is defined by an intrinsic heterogeneity on the histopathological and molecular level as well as response to therapy and outcome. In addition to classical histopathological features, breast cancer can be categorized into at least five major subtypes based on comprehensive gene expression profiling: luminal A, luminal B, basal-like, ERBB2-positive, and normal-like breast cancer. Genetically engineered mouse models can serve as tools to study the molecular underpinnings for this disease. Given the genetic complexity that drives the initiation and progression of individual breast cancer subtypes, it is evident that certain models can reflect only particular aspects of this malignancy. In this book chapter, we will primarily focus on advances in modeling breast cancer at defined stages of carcinogenesis using genetically engineered mice. We will discuss the ability as well as shortcomings of these models to faithfully recapitulate the spectrum of human breast cancer subtypes.

show abstract

Estrogen receptor-positive mammary tumorigenesis in TGFα transgenic mice progresses with progesterone receptor loss

Cited by 22 publications

References 34 publications

Molecular characterizations of Nop16 in murine mammary tumors with varying levels of c-Myc

Molecular characterizations of Nop16 in murine mammary tumors with varying levels of c-Myc

Prolactin Drives Estrogen Receptor-α-Dependent Ductal Expansion and Synergizes with Transforming Growth Factor-α to Induce Mammary Tumors in Males

Mouse Models of Breast Cancer

Contact Info

Product

Resources

About