Evaluating the biological properties of synthetic 4-nitrophenyl functionalized benzofuran derivatives with telomeric DNA binding and antiproliferative activities

Carella, Antonio; Roviello, Valentina; Iannitti, Roberta; Palumbo, Rosanna; Manna, Sara La; Marasco, Daniela; Trifuoggi, Marco; Diana, Rosita; Roviello, Giovanni N.

doi:10.1016/j.ijbiomac.2018.09.153

Cited by 47 publications

(31 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The synthetic route for the benzodifuran precursor BDF (in Scheme 1) followed a reported procedure [40] consisting in the diazotization of 4-nitroaniline and the coupling of the diazonium salt on benzoquinone. By appropriate choice of the substituted cyanoacetate reacting with 4'-nitro-[1,1'-biphenyl]-2,5-dione [40] a wide range of substituted benzodifuran derivatives could be obtained. In our case, after some preliminary tests, the acetyl substituents were chosen as a good compromise between solubility and ability to crystallization.…”

Section: Resultsmentioning

confidence: 99%

“…No crystal decay was detected. Data were processed using XDS (X-ray Detector Software) for processing single-crystal monochromatic diffraction data recorded) with the data collection statistics reported in Table 1 [40,49]. The crystal gave a primitive monoclinic cell of a = 16.41 Å, b = 4.78 Å, c = 25.89 Å, b=91.2 • , V = 2030 Å 3 and P 1 2 1 /m 1 symmetry was confirmed by Laue group analysis from unmerged intensity using POINTLESS 1.11.21 [50] and no data twinning was detected.…”

Section: X-ray Crystallographymentioning

confidence: 99%

“…Intercrossed excited state between the low-lying local exciton (LE) and charge transfer (CT) exciton results from the D-A interaction. Obviously, the molecular geometry is crucial for the process.Benzodifuran derivatives have drawn attention for a wide range of biological and pharmacological applications, including antimicrobial, antiviral, analgesic and antitumor [37][38][39][40] activity. This class of heterocyclic compounds are also employed in dyes industry as pigments and in different fields of optoelectronics and photonics.…”

mentioning

confidence: 99%

See 2 more Smart Citations

A Novel DR/NIR T-Shaped AIEgen: Synthesis and X-Ray Crystal Structure Study

et al. 2020

Self Cite

View full text Add to dashboard Cite

We developed a new benzodifuran derivative as the condensation product between 2,6-diamino -4-(4-nitrophenyl)benzo [1,2-b:4,5-b']difuran-3,7-dicarboxylate and 3-hydroxy-2-naphthaldehyde. The intramolecular hydrogen-bond interactions in the terminal half-salen moieties produce a sterically encumbered highly conjugated main plane and a D-A-D (donor-acceptor-donor) T-shaped structure. The novel AIEgen (aggregation-induced enhanced emission generator) fulfils the requirement of RIR (restriction of intramolecular rotation) molecules. DR/NIR (deep red/near infrared) emission was recorded in solution and in the solid state, with a noteworthy photoluminescence quantum yield recorded on the neat crystals which undergo some mechanochromism. The crystal structure study of the probe from data collected at a synchrotron X-ray source shows a main aromatic plane π-stacked in a columnar arrangement.Crystals 2020, 10, 269 2 of 15 law [20][21][22] the intrinsic low band-gap of such DR/NIR emitters makes them especially vulnerable to the ACQ effect [23] due to higher vibrionic coupling between the ground and excited states. Therefore, most of the AIEgens reported emit blue and green lights. Although they are highly sought after for red OLEDs (Organic Light Emitting Diodes), night-vision devices, secured displays, optical waveguides and in the wide field of bio and chemo-sensing [24][25][26][27][28], there are fewer efficient DR/NIR (deep red/near infrared) materials. Of particular interest are AIE fluorophores with intense emission at DR/NIR region owing to their deep tissue penetration, photo-stability and minimum interference in living systems [25,29,30]. Their applications are closely related to cell imaging and DNA and protein sensing [31][32][33].Novel molecular construction of DR/NIR AIEgens can be achieved with electron donor (D) and electron acceptor (A) blocks connected through π-conjugated frameworks. The most fundamental phenomenon governing the spectroscopic properties is the intramolecular charge transfer (ICT) process from the donor to the acceptor in the excited state [34][35][36]. Intercrossed excited state between the low-lying local exciton (LE) and charge transfer (CT) exciton results from the D-A interaction. Obviously, the molecular geometry is crucial for the process.Benzodifuran derivatives have drawn attention for a wide range of biological and pharmacological applications, including antimicrobial, antiviral, analgesic and antitumor [37][38][39][40] activity. This class of heterocyclic compounds are also employed in dyes industry as pigments and in different fields of optoelectronics and photonics. Due to the excellent semiconducting properties [41,42], benzodifuran scaffolds are used as nonlinear optical materials [43], for dye sensitized solar cells [44] and in organic solar cell and transistors. Finally, as electron-rich building blocks they have a potential in the constructing of photoluminescent materials [45][46][47] Herein, we developed a new benzodifuran derivative from 2,6-diamino-4-(4-nitrophenyl) ...

show abstract

Section: Resultsmentioning

confidence: 99%

Section: X-ray Crystallographymentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

A Novel DR/NIR T-Shaped AIEgen: Synthesis and X-Ray Crystal Structure Study

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…The experiments were performed at 15 • C using the intrinsic fluorescence of G4 DNAs as reported previously [46], using an excitation wavelength of 270 nm and a fluorescence emission wavelength ranging from 330 to 500 nm on a Jasco FP 8300 spectrofluorometer using a 10 mm path-length quartz cuvette. The acquisition parameters were set as follows: excitation and emission slits at 5 nm; 200 nm/min scan rate; 0.5 nm data interval averaging time at 0.050 s, PMT voltage at "medium".…”

Section: Fluorescence Studiesmentioning

confidence: 99%

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

et al. 2020

Self Cite

View full text Add to dashboard Cite

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

show abstract

“…Decomposition temperatures In the present paper a planar diamino-BDF structure, bearing two alkoxy substituents and a p-nitrophenyl group (compound BDF-NO 2 in Scheme 1) was employed to obtain different macromolecular solid-state emitters. In a previous article [19], a mechanistic study of the effect of the same BDF derivative on tumor cells was performed by means of fluorescence techniques, focusing interest on its photoluminescence (PL) properties in solution. Here we collected structural information on the difunctional BDF derivative by single crystals X-ray analysis.…”

Section: Characterizationmentioning

confidence: 99%

Novel Solid-State Emissive Polymers and Polymeric Blends from a T-Shaped Benzodifuran Scaffold: A Comparative Study

et al. 2020

Self Cite

View full text Add to dashboard Cite

Two novel polyimines were synthesized from a benzodifuran based diamino monomer and two dialdehydes bearing bulky groups and a flexible spacer. The polymers display tuned luminescence performance according to the presence of half-salen groups. The effect of the intramolecular bond on the emission properties were examined. Two model compounds, replicating the same emissive Schiff base cores, were synthetized. From the models, dye-doped blends in the fluorophore/matrix ratio, resembling the polymers, were produced. Amorphous thin films of the covalent polymers and the polymeric blends were obtained by spin-coating technique. The Photoluminescent (PL) response of the different macromolecular systems were qualitatively and quantitatively examined and compared.

show abstract

Evaluating the biological properties of synthetic 4-nitrophenyl functionalized benzofuran derivatives with telomeric DNA binding and antiproliferative activities

Cited by 47 publications

References 44 publications

A Novel DR/NIR T-Shaped AIEgen: Synthesis and X-Ray Crystal Structure Study

A Novel DR/NIR T-Shaped AIEgen: Synthesis and X-Ray Crystal Structure Study

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

Novel Solid-State Emissive Polymers and Polymeric Blends from a T-Shaped Benzodifuran Scaffold: A Comparative Study

Contact Info

Product

Resources

About