The blood brain barrier (BBB) represents a challenge in the development of new nano-delivery systems able to reach the central nervous system (CNS). In order to test the efficacy of these nanocarriers, it is fundamental to use in vitro models that resemble the in vivo cell culture conditions. Here, we demonstrate for the first time the ability of a membranotropic peptide, namely gH625, to transport a cargo-acting as a shuttle-across the BBB layer under flow conditions that mimic the blood flow rate. To this aim, a BBB microfluidic device was designed based on a transparent polyester porous membrane sandwiched between a top and a bottom overlying channel made of poly(methyl methacrylate) (PMMA). Our data clearly indicate that this microfluidic system allows the growth of brain endothelial bEnd.3 cells and the formation of a confluent layer at 7 days of culture that hinders the passage of nanoparticles compared to porous membrane alone. The device was validated at a 5 μL/min working flow rate, where the capability of the model to remain intact after nanoparticle passage was shown. Very interestingly, the decoration with the gH625 peptide enhances the adhesion of nanoparticles to the endothelial layer and the BBB crossing in flow conditions, thus confirming the efficacy of the gH625 as a delivery platform to the brain. Biotechnol. Bioeng. 2017;114: 1087-1095. © 2016 Wiley Periodicals, Inc.

The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract the Bcl-2 expression. Among these are Peptide Nucleic Acids (PNAs). The absence of charges on PNA backbones allows the formation of PNA/DNA complexes provided with higher stability than the corresponding natural DNA/DNA counterparts. To date, the use of PNAs in antigene or antisense strategies is strongly limited by their inability to efficiently cross the cellular membranes. With the aim of downregulating the expression of Bcl-2, we propose here a novel antigene approach which uses oncolytic adenoviral vectors (OAds) as a new cancer cell-targeted PNA delivery system. The ability of oncolytic Ad5D24 vectors to selectively infect and kill cancer cells was exploited to transfect with high efficiency and selectivity a short cytosine-rich PNA complementary to the longest loop of the main G-quadruplex formed by the 23-base-long bcl2midG4 sequence located 52–30 bp upstream of the P1 promoter of Bcl-2 gene. Physico-chemical and biological investigations confirmed the ability of the PNA-conjugated Ad5D24 vectors to load and transfect their PNA cargo into human A549 and MDA-MB-436 cancer cell lines, as well as the synergistic (OAd+PNA) cytotoxic effect against the same cell lines. This approach holds promise for safer chemotherapy because of reduced toxicity to healthy tissues and organs.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

A major issue in chemotherapy is the lack of specificity of many antitumor drugs, which cause severe side effects and an impaired therapeutic response. Here we report on the design and characterization of model tumor activated prodrug-conjugated polystyrene (PS) nanoparticles (TAP-NPs) for the release of doxorubicin (Dox) triggered by matrix metalloprotease-2 (MMP2) enzyme, which is overexpressed in the extracellular matrix of tumors. In particular, TAP-NPs were produced by attaching Dox to poly(ethylene glycol) (PEG) through two MMP2-cleavable enzymes. The resulting adduct was then tethered to PS NPs. Results showed that Dox release was actually triggered by MMP2 cleavage and was dependent on enzyme concentration, with a plateau around 20 nM. Furthermore, significant cell cytotoxicity was observed towards three cell lines only in the presence of MMP2, but not in cells without enzyme pre-treatment, even after NP internalization by cells. These findings indicate the potential of TAP-NPs as suitable nanocarriers for an on demand, tumor--specific delivery of antitumor drugs after the response to an endogenous stimulus. Further advancements will focus on the translation of this production technology to biodegradable systems for the safe transport of cytotoxic drug to tumor tissues.