Evaluation of two independent protocols for the extraction of DNA and RNA from different tissues of sea cucumber Isostichopus badionotus

Puch-Hau, Carlos; Sánchez‐Tapia, Itzel A.; Patiño-Suárez, V.; Olvera‐Novoa, Miguel A.; Klanian, Mariel Gullian; Quintanilla-Mena, Mercedes; Zapata-Pérez, Omar

doi:10.1016/j.mex.2019.07.010

Cited by 16 publications

(7 citation statements)

References 15 publications

(17 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Total RNA was extracted using TRIzol Reagent ® (Ambion © , Cat. 15596-026) essentially in accordance with Puch-Hau et al, 2019 [ 54 ]. Quantification of total RNA was done with a Qubit 2.0 (Thermo Fisher Scientific, Mexico City, MX, Mexico), and its quality [RNA integrity number (RIN)] assessed using an Agilent 2100 Bioanalyzer ® with the RNA 6000 Nano Lab Chip Kit ® (Agilent Technologies © , Santa Clara, CA, USA).…”

Section: Methodssupporting

confidence: 87%

Comparative Transcriptomes of the Body Wall of Wild and Farmed Sea Cucumber Isostichopus badionotus

Martín‐Hernández

Rodríguez-Canul²,

Kantún-Moreno³

et al. 2021

IJMS

Self Cite

View full text Add to dashboard Cite

Overfishing of sea cucumber Isostichopus badionotus from Yucatan has led to a major population decline. They are being captured as an alternative to traditional species despite a paucity of information about their health-promoting properties. The transcriptome of the body wall of wild and farmed I. badionotus has now been studied for the first time by an RNA-Seq approach. The functional profile of wild I. badionotus was comparable with data in the literature for other regularly captured species. In contrast, the metabolism of first generation farmed I. badionotus was impaired. This had multiple possible causes including a sub-optimal growth environment and impaired nutrient utilization. Several key metabolic pathways that are important in effective handling and accretion of nutrients and energy, or clearance of harmful cellular metabolites, were disrupted or dysregulated. For instance, collagen mRNAs were greatly reduced and deposition of collagen proteins impaired. Wild I. badionotus is, therefore, a suitable alternative to other widely used species but, at present, the potential of farmed I. badionotus is unclear. The environmental or nutritional factors responsible for their impaired function in culture remain unknown, but the present data gives useful pointers to the underlying problems associated with their aquaculture.

show abstract

Section: Methodssupporting

confidence: 87%

Comparative Transcriptomes of the Body Wall of Wild and Farmed Sea Cucumber Isostichopus badionotus

Martín‐Hernández

Rodríguez-Canul²,

Kantún-Moreno³

et al. 2021

IJMS

Self Cite

View full text Add to dashboard Cite

show abstract

“…Total RNA from each sample was extracted, referring to the supplier's direction TRIzol (TaKaRa, Dalian, China). 24 The extracted RNA concentration was quantified using NanoDrop (NanoDrop Technologies, Wilmington, WI, USA). Subsequently, these RNAs were reversely transcribed into the first-strand complementary DNA (cDNA) by using the PrimeScript RT Master Mix Reagent (TaKaRa).And RT-qPCR was executed on a LightCycler ® 480 (Roche diagnostics, Mannheim, Germany) with an SYBR Green PCR kit (Takara).…”

Section: Real-time Quantitative Polymerase Chain Reaction (Rt-qpcr)mentioning

confidence: 99%

<p>Circular RNA circNHSL1 Contributes to Gastric Cancer Progression Through the miR-149-5p/YWHAZ Axis</p>

Hui¹,

Tian²,

He³

2020

CMAR

View full text Add to dashboard Cite

Background: Gastric cancer (GC) is a considerable health burden around the world. Circular RNA Nance-Horan syndrome-like 1 (circNHSL1) is reported to be highly expressed in GC. Nevertheless, the function and molecule mechanism of circNHSL1 are still unclear. Methods: The expression levels of circNHSL1, microRNA-149-5p (miR-149-5p) and YWHAZ were detected by real-time quantitative polymerase chain reaction (RT-qPCR). The subcellular fractionation identified the remarkable cytoplasmic localization of circNHSL1. Cell migration and invasion were measured by transwell assays. The levels of glutamine, glutamate and α-ketoglutarate (α-KG) were assessed by the corresponding kit. The protein levels of CD63, CD9, CD81, alanine, serine, cysteine-preferring transporter 2 (ASCT2), glutaminase 1 (GLS1), and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ) were detected by Western blot assay. The binding relationship between miR-149-5p and circNHSL1 or YWHAZ was predicted by starBase 3.0 and then verified by RNA pull-down and dual-luciferase reporter assays. Xenograft tumor model examined the biological role of circNHSL1 in vivo. Exosomes were examined by a transmission electron microscope and nanoparticle tracking analysis (NTA). Results: CircNHSL1 was highly expressed in GC cell-derived exosomes, GC tissues, and cells. Its knockdown impeded GC cell migration, invasion, and glutaminolysis. Mechanism analysis showed that circNHSL1 could affect YWHAZ expression by sponging miR-149-5p, thereby regulating GC progression. CircNHSL1 downregulation blocked GC tumor growth in vivo. Conclusion: Our studies disclosed that circNHSL1 knockdown repressed migration, invasion, and glutaminolysis in vitro and inhibited tumor growth in vivo by miR-149-5p/ YWHAZ axis in GC, implying an underlying circRNA-targeted therapy for GC treatment.

show abstract

“…GBM tissues and cells were harvested and suspended in TRIzol reagent (Takara) for isolation of total RNA as described in a previous study. [ 23 ] A total of 1 μg RNA was used to synthesize the complementary DNA (cDNA) using PrimeScript One Step qRT‐PCR Kit (Takara). The synthesized cDNA was subjected to quantitative reverse transcription‐polymerase chain reaction using SYBR (Thermo Fisher Scientific) in the presence of the following specific primers (Sangon): ANXA2P2: forward, 5′‐CATTGTGACCAACCGCGACA‐3′; reverse, 5′‐GCCCAAAATCACCGTCTCCAG‐3′; β‐actin: forward, 5′‐CTCGCCTTTGCCGATCC‐3′; reverse, 5′‐GGGGTACTTCAGGGTGAGGA‐3′).…”

Section: Methodsmentioning

confidence: 99%

Pseudogene ANXA2P2 knockdown shows tumor‐suppressive function by inhibition of the PI3K/PKB pathway in glioblastoma cells

Zhi

Zuo

et al. 2021

J Biochem & Molecular Tox

View full text Add to dashboard Cite

The pseudogene annexin A2 pseudogene 2 (ANXA2P2) is highly expressed in glioblastoma (GBM). However, its role and mechanism involved in the progression of GBM remain poorly understood. ANXA2P2 messenger RNA expression was measured by quantitative reverse transcription‐polymerase chain reaction. The protein levels were detected by Western blot. Cell viability was evaluated by the 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide and lactate dehydrogenase (LDH) release assays. Cell invasive ability was investigated by the transwell assay and by epithelial–mesenchymal transition (EMT). Cell apoptosis was examined by flow cytometry. The results showed that ANXA2P2 expression was increased in GBM tissues and cells. Silencing of ANXA2P2 inhibited the activation of the phosphoinositide 3‐kinase (PI3K)/protein kinase B (PKB) pathway in GBM cells. Knockdown of ANXA2P2 decreased cell viability, promoted LDH release, suppressed cell invasive ability, and EMT, and induced cell apoptosis in GBM cells. The addition of the PI3K/PKB activator 740Y‐P abrogated the effects of ANXA2P2 knockdown on cell viability, LDH release, invasive ability, and apoptosis. In conclusion, knockdown of ANXA2P2 inhibited cell viability and invasion but promoted the apoptotic rate by suppressing the PI3K/PKB pathway in GBM cells. ANXA2P2 may represent a new target for the treatment of GBM.

show abstract

Evaluation of two independent protocols for the extraction of DNA and RNA from different tissues of sea cucumber Isostichopus badionotus

Abstract: Graphical abstract

Cited by 16 publications

References 15 publications

Comparative Transcriptomes of the Body Wall of Wild and Farmed Sea Cucumber Isostichopus badionotus

Comparative Transcriptomes of the Body Wall of Wild and Farmed Sea Cucumber Isostichopus badionotus

<p>Circular RNA circNHSL1 Contributes to Gastric Cancer Progression Through the miR-149-5p/YWHAZ Axis</p>

Pseudogene ANXA2P2 knockdown shows tumor‐suppressive function by inhibition of the PI3K/PKB pathway in glioblastoma cells

Contact Info

Product

Resources

About