Evolution of dark-spored Myxomycetes (slime-molds): Molecules versus morphology

Fiore-Donno, Anna Maria; Meyer, Marianne; Baldauf, Sandra L.; Pawlowski, Jan

doi:10.1016/j.ympev.2007.12.011

Cited by 108 publications

(66 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…DNA was extracted as described elsewhere (Fiore-Donno et al, 2008), and it was amplified by polymerase chain reaction (PCR) using the primers SA' (TGGTTGATCCTGCCAGTAGTGT) and SU19R (TGTCCTCTAATTGTTACTCGA), Mangotaq mix (Bioline, London, UK) and the following cycling parameters: 45 s at 94 1C, 33 Â (25 s at 94 1C, 60 s at 42 1C, 3.5 min at 72 1C) and 5 min at 72 1C. To obtain nearly complete SSU rRNA gene sequences, four overlapping sequence fragments were obtained using the primers SA 0 , SU19R, and S4, S900R, S11.5, SR15, DA2, RB2 (Fiore-Donno et al, 2008) and the same polymerase chain reaction conditions. Purified polymerase chain reaction products (SureClean kit, Bioline) were sequenced directly by Macrogen Korea (Geumcheon-gu, Seoul, South Korea).…”

Section: Methodsmentioning

confidence: 99%

Using environmental niche models to test the ‘everything is everywhere’ hypothesis for Badhamia

et al. 2013

View full text Add to dashboard Cite

It is often discussed whether the biogeography of free-living protists is better explained by the 'everything is everywhere'(EiE) hypothesis, which postulates that only ecology drives their distribution, or by the alternative hypothesis of 'moderate endemicity' in which geographic barriers can limit their dispersal. To formally test this, it would be necessary not only to find organisms restricted to a geographical area but also to check for their presence in any other place with a similar ecology. We propose the use of environmental niche models to generate and test null EiE distributions. Here we have analysed the distribution of 18S rDNA variants (ribotypes) of the myxomycete Badhamia melanospora (belonging to the protozoan phylum Amoebozoa) using 125 specimens from 91 localities. Two geographically structured groups of ribotypes congruent with slight morphological differences in the spores can be distinguished. One group comprises all populations from Argentina and Chile, and the other is formed by populations from North America together with human-introduced populations from other parts of the world. Environmental climatic niche models constructed separately for the two groups have significant differences, but show several overlapping areas. However, only specimens from one group were found in an intensively surveyed area in South America where both niche models overlap. It can be concluded that everything is not everywhere for B. melanospora. This taxon constitutes a complex formed by at least two cryptic species that probably diverged allopatrically in North and South America.

show abstract

Section: Methodsmentioning

confidence: 99%

Using environmental niche models to test the ‘everything is everywhere’ hypothesis for Badhamia

et al. 2013

View full text Add to dashboard Cite

show abstract

“…Group I introns are very common in Myxogastria (Fiore-Donno et al 2008), being found in nine insertion sites (Lundblad et al 2004) always located in very conserved parts of the gene (Haugen et al 2003;Wikmark et al 2007). They are mobile or inferred to be mobile and introns at the same position in diverse organisms are more related to each other than introns in the same organism, suggesting lateral transfer (Lundblad et al 2004)-but there are cases of vertically inherited introns (Lundblad et al 2004).…”

Section: Discussionmentioning

confidence: 99%

“…Echinostelium spp. and Semimorula liquescens, the sister group of Stemonitida and Physarida in SSU rRNA gene analyses, were used as outgroups (Fiore-Donno et al 2008, 2010). An alignment of 1,451 positions, comprising 54 taxa, was used for phylogenetic analyses.…”

Section: Methodsmentioning

confidence: 99%

Invalidation of Hyperamoeba by Transferring its Species to Other Genera of Myxogastria

Fiore‐Donno¹,

Kamono²,

Chao³

et al. 2017

Preprint

Self Cite

View full text Add to dashboard Cite

ABSTRACT. The genus Hyperamoeba Alexeieff, 1923 was established to accommodate an aerobic amoeba exhibiting three life stagesamoeba, flagellate, and cyst. As more species/strains were isolated, it became increasingly evident from small subunit (SSU) gene phylogenies and ultrastructure that Hyperamoeba is polyphyletic and its species occupy different positions within the class Myxogastria. To pinpoint Hyperamoeba strains within other myxogastrid genera we aligned numerous myxogastrid sequences: whole small subunit ribosomal (SSU or 18S rRNA) gene for 50 dark-spored (i.e. Stemonitida and Physarida) Myxogastria (including a new ''Hyperamoeba''/ Didymium sequence) and a $ 400-bp SSU fragment for 147 isolates assigned to 10 genera of the order Physarida. Phylogenetic analyses show unambiguously that the type species Hyperamoeba flagellata is a Physarum (Physarum flagellatum comb. nov.) as it nests among other Physarum species as robust sister to Physarum didermoides. Our trees also allow the following allocations: five Hyperamoeba strains to the genus Stemonitis; Hyperamoeba dachnaya, Pseudodidymium cryptomastigophorum, and three other Hyperamoeba strains to the genus Didymium; and two further Hyperamoeba strains to the family Physaridae. We therefore abandon the polyphyletic and redundant genus Hyperamoeba. We discuss the implications for the ecology and evolution of Myxogastria, whose amoeboflagellates are more widespread than previous inventories supposed, being now found in freshwater and even marine environments.

show abstract

“…The Echinosteliales are defined by light, rarely dark colored spores produced in a minute sporocarp usually having a stipe, columella and capillitium. This small order has been considered to be either a specialized group derived from the Physarales (Collins 1979) or a basal group derived from the Protostelia (Spiegel 1990); however recent DNA studies (Fiore-Donno et al 2005, 2008, 2012 place this order as a basal sister group to the dark spored endosporous orders, but not apparently closely related to the Protostelia. The Liceales, characterized by light or dark colored spores and sporocarps which lack true capillitia, are considered to be a somewhat variable group composed of three rather different families; and so far the limited DNA information (FioreDonno et al 2009(FioreDonno et al , 2013 generally supports this conclusion.…”

Section: Taxonomymentioning

confidence: 99%

Sporophore morphology and development in the myxomycetes: a review

Clark¹,

Haskins²

2014

Mycosphere

View full text Add to dashboard Cite

Since the sporophores of the myxomycetes are the primary basis of taxonomy in the myxomycetes, an understanding of the development and range of variations of the various morphological structures is essential to constructing a valid system. A review of the morphology of the stipe, peridium, capillitium, and spores and their developmental aspects was undertaken and the resulting morphological hypotheses tested against recent advancements in DNA phylogeny, isozyme and DNA population, and genetic reproduction studies.

show abstract

Evolution of dark-spored Myxomycetes (slime-molds): Molecules versus morphology

Cited by 108 publications

References 24 publications

Using environmental niche models to test the ‘everything is everywhere’ hypothesis for Badhamia

Using environmental niche models to test the ‘everything is everywhere’ hypothesis for Badhamia

Invalidation of Hyperamoeba by Transferring its Species to Other Genera of Myxogastria

Sporophore morphology and development in the myxomycetes: a review

Contact Info

Product

Resources

About