Experimental infection of Tilapia Lake Virus (TiLV) in Nile tilapia ( Oreochromis niloticus ) and red tilapia ( Oreochromis spp.)

Detection of tilapia lake virus (TiLV) infection by PCR in farmed and wild Nile tilapia (Oreochromis niloticus) from Lake Victoria

“…Furthermore, the rapid rate at which the disease is being reported to cause outbreaks in different continents across the world (Fathi et al., ; Nicholson et al., ; Surachetpong et al., ) calls for the development of rapid diagnostic tools for prompt virus identification to pave way for the design of timely disease control strategies. Thus far, diagnosis of reported outbreaks has mainly been based on virus isolation, characterization, culture followed by reinfection in susceptible fish to demonstrate the characteristic syncytial hepatitis and other pathological lesions in susceptible fish (Del‐Pozo et al., ; Tattiyapong, Dachavichitlead, & Surachetpong, ; Tsofack et al., ). Although these steps fulfil the Koch's postulates by establishing the disease–causal factor relationship, virus isolation, culture and reinfection are not ideal for surveillance programmes especially in situations with high number of samples.…”

Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish

“…A 491 bp cDNA fragment from the segment three of the TiLV genome (GenBank accession number KX631923) was amplified using specific primers (Eyngor et al., ) (Nested ext‐2: TTGCTCTGAGCAAGAGTACC and Nested ext‐1: TATGCAGTACTTTCCCTGCC) and cloned into the pTG19‐T vector (Vivantis). The RT‐PCR protocol was performed as previously described (Tattiyapong et al., ). The recombinant plasmid later called pTiLV was transformed into the E. coli strain DH5 alpha.…”

“…Subsequently, the disease investigation led to the identification of a novel, orthomyxo‐like virus—tilapia lake virus (TiLV)—as a causative agent of these field outbreaks (Bacharach et al., ; Eyngor et al., ; Surachetpong et al., ). Recent study suggested that the isolated virus caused cytopathic effect in E‐11 cells, and the disease could be reproduced in susceptible Nile and red hybrid tilapia (Tattiyapong et al, ). TiLV is a negative, single‐stranded, RNA genome‐enveloped virus comprising 10 genomic segments.…”

Minimal risk of tilapia lake virus transmission via frozen tilapia fillets

“…In a preliminary experiment, naïve red hybrid tilapia ( n = 10; weight = 10 ± 0.5 g) were intraperitoneally (IP) injected with 50 μl of TiLV strain VET‐KUTV01, isolated from red hybrid tilapia obtained from Pathum Thani province, Thailand (Tattiyapong et al., ), in a titre of 1 × 10 5 tissue culture infective dose by 50% (TCID 50 )/ml. At 6 days post‐infection (dpi), 7 clinically TiLV‐infected fish were killed with an overdose of clove oil (Aquanes; Better Pharma, Bangkok, Thailand) and 3 separate fillets (100 mg each) from each fish were collected and stored at commercial freezing temperature (−20°C) for 0, 14 and 28 days.…”

“…Subsequently, TiLV was found in many countries including Ecuador (Bacharach et al., ), Colombia (Kembou Tsofack et al., ), Egypt (Fathi et al., ; Nicholson et al., ), Thailand (Dong et al., ; Surachetpong et al., ), India (Behera et al., ), Indonesia (Koesharyani, Gardenia, Widowati, Khumaira, & Rustianti, ), Uganda and Tanzania (Mugimba et al., ), and Malaysia (Amal et al., ). In clinically infected fish, TiLV has been detected in several organs including liver, spleen, anterior kidney, gills, heart as well as muscle (Dong et al., ; Tattiyapong, Dachavichitlead, & Surachetpong, ; Tattiyapong, Sirikanchana, & Surachetpong, ). To date, various methods have been used for the diagnosis of TiLV such as reverse transcription–polymerase chain reaction (RT‐PCR), RT‐quantitative PCR (RT‐qPCR), histopathology and viral isolation in susceptible cells (Behera et al., ; Jaemwimol et al., ; Kembou Tsofack et al., ; Tattiyapong et al., ; Waiyamitra et al., ).…”