Expressed sequence tags from cDNA library prepared from gills of the swimming crab, Portunus trituberculatus

Untitled

“…In order to clone the PtFer open reading frame (ORF), we designed two specific primers based on the EST (PT0013D12) obtained from the ESTs library (Xu et al, 2010) as following: PtFer-P1 (5′CCGAATTCATGTGTAGCCAAGTCCGCCAGA 3′, position: 1-22bp), PtFer-P2 (5′CGCTCGAGTTAAGCAAGCTCCTTGTCAAAC 3′, position: 492-513bp) with restriction enzyme EcoR I and Xho I sites respectively (underlined, see Figure 1). Then the PCR reaction mixture contained 10pmol of each primer 0.6μl, 10×PCR buffer 2.5μl, 10mM of each dNTP (with 1.5 mM MgCl 2 ) 2μl , H 2 0 18.1μl, 5U/μl TaqDNA polymerase 0.2μl in a total volume of 25μl (Aidlab Biotechnologies, China).…”

“…The partial PtFer gene (PT0013D12) from the swimming crab was obtained from our previous constructed gill cDNA library (Xu et al, 2010). By using primers (PtFer-P1 and PtFer-P2), the coding sequence of the full-length cDNA of PtFer was obtained in our study.…”

“…A transcriptome analysis of the gills of Portunus trituberculatus under the salinity stress was conducted by the Illumina Deep Sequencing technology aimed to explain mechanism of osmoregulation in P. trituberculatus when faced salinity challenges (Lv et al 2013). In our previous study, gill cDNA library of expressed sequence tags (ESTs) was constructed from the swimming crab exposed to two different salinity challenges (10 and 35ppt) (Xu et al, 2010). A total of 2426 transcripts were selected for microarray construction based on criteria described in Xu et al (2010).…”

“…In our previous study, gill cDNA library of expressed sequence tags (ESTs) was constructed from the swimming crab exposed to two different salinity challenges (10 and 35ppt) (Xu et al, 2010). A total of 2426 transcripts were selected for microarray construction based on criteria described in Xu et al (2010). The results showed that the ferritin (PtFer) gene was found to have different expression levels in the swimming crab exposed to 10 or 35 ppt salinity challenges compared with the 25 ppt normal seawater, which indicated that the PtFer gene might be involve in the salinity acclimation (Xu and Liu, 2011).…”

Chitinase gene responses and tissue sensitivity in an intertidal mud crab (Macrophthalmus japonicus) following low or high salinity stress

“…Molecular and cellular responses of osmoregulatory enzymes, iron transport proteins, and immune metabolism-related genes have been studied in the gills of crustaceans and teleost under acute salinity stress (Henry et al 2002(Henry et al , 2003Scott et al 2004;Chung and Lin 2006;de la Vega et al 2007). Gene expression analysis has been conducted using different salinity stresses via cDNA microarray chip and expressed sequence tags (ESTs) in order to study the osmoregulation mechanism in swimming crab Portunus trituberculatus (Xu et al 2010;Xu and Liu 2011) and it has been found that ion transport processes, amino acid metabolism, and synthesis processes and chitin metabolic processes have been involved in gills osmoregulation process. Recently, transcriptome analysis of the gills of the P. trituberculatus exposed to high and low salinity using Illumina Deep Sequencing Technology (Lv et al 2013) showed there were differentially expressed UniGenes enriched for the chitin metabolic process suggesting that the chitin metabolic process may be involved in osmoregulation or may be affected by salinity stress.…”