Expression cloning of a cDNA encoding the bovine histamine H1 receptor.

Abstract

Since Dale and Laidlaw (1) first reported the contraction of smooth muscle by histamine, the pharmacological significance of this phenomenon has been extensively investigated. Three subtypes of histamine receptor (H1, H2, and H3) are known. The H1 receptor was identified by Ash and Schild (2) and H1 receptor antagonists have been used in the therapy of many allergic diseases, including urticaria, allergic rhinitis, pollenosis, and bronchial asthma. In peripheral tissues, the histamine H1 receptor mediates the contraction of smooth muscles, increase in capillary permeability due to contraction of terminal venules, and catecholamine release from adrenal medulla (3), as well as mediating neurotransmission in the central nervous system (4). Although signal transduction of the H1 receptor through Ca2l mobilization via an increase in the intracellular inositol 1,4,5-trisphosphate level has been extensively investigated (5,6), little is known about the molecular structure of the histamine H1 receptor. Recently, Isolation ofPoly(A)+ RNA. Total RNA was extracted by the acid guanidinium isothiocyanate/phenol/chloroform method (11). Poly(A)+ RNA was isolated by chromatography on oligo(dT)-cellulose (12).Expression Cloning of Histamine HI Receptor cDNA. Bovine adrenal medullary poly(A)+ RNA ('180 ug) was sizefractionated on a 5-25% (wt/vol) sucrose-density gradient.An aliquot (1 p1L) of each poly(A)+ RNA fraction (20,ul) was injected into Xenopus oocytes, and electrophysiological assay by measuring Ca2+-dependent inward Cl-currents was done as described (9). The fraction that showed the highest histamine-induced inward Cl-currents was used for oligo(dT)-primed cDNA synthesis. Double-stranded cDNAs of >2-kilobase (kb) pairs were size-selected by agarose gel electrophoresis followed by elution with Geneclean II (Bio 101, La Jolla, CA) and were ligated into AZAPII (Stratagene) at the EcoRI site. The library was divided and amplified in 65 pools of "'-20,000 independent clones each. In vitro transcription was done essentially according to the procedure ofJulius et al. (13). RNA transcripts (=5 ng) from each pool were individually injected into Xenopus oocytes. After incubation for 1-2 days, the oocytes were tested for inward Cl-currents induced by 100 ,uM histamine under a voltage clamp at -60 mV. The single positive pool of 20,000 clones was progressively subdivided into smaller pools of 8000, 4000, 400, and 15 clones until finally a single clone was obtained. cDNA encoding the histamine H1 receptor was sequenced by the M13 chain-termination method (14) using a DNA sequencer (model 370A, Applied Biosystems). The sequence homology search was done by using DNASIS (Hitachi Software Engineering, Yokohama, Japan).

Stable Expression of Human H1‐histamine‐receptor cDNA in Chinese Hamster Ovary Cells

“…The tissue distribution of human Hi-histamine-receptor mRNA was not comparable to that of the bovine, rat and guinea-pig homologues (Yamashita et al, 1991 ;Horio et al, 1993). An additional transcript was specifically and abundantly found in the human brain tissue, whereas no brain specific mRNA was present in the bovine, rat and guinea-pig.…”

“…Binding conditions are as described in Materials and Methods. Data are presented as the mean t SD (n 2 3) receptors (Yamashita et al, 1991;Fujimoto et al, 1993;Horio et al, 1993).…”

“…Oligonucleotides, derived from sequences present in the bovine H,-histaminic-receptor DNA (Yamashita et al, 1991), were used in the PCR (Saiki et al, 1988) to amplify a 661-bp DNA fragment, corresponding to a part of the human HI histamine receptor, from a human lung cDNA library (Quick clone, Clontech). Sequences of the primers were as follows: 5' TACAAAGCTTACCATGACCTGTCCCAACTCCTCCT-GCGTCTTCGAAGACAAG 3' (5' end of the coding sequence for the bovine H, receptor) and 5' AGCCTTGTAGA-CAAGTA 3' (complementary sequence within the fifth transmembrane region of the bovine H, receptor).…”

“…Recently the bovine cDNA, the rat and guinea-pig genes have been cloned, and Northern blot analysis indicates that the brain expressed a single mRNA, as is also the case in other organs (Yamashita et al, 1991;Fujimoto et al, 1993;Horio et al, 1993).…”

Modulation of antagonist binding to histamine H1‐receptors by sodium ions and by 2‐amino‐2‐hydroxymethyl‐propan‐1,3‐diol HCl

“…The most direct evidence for the involvement of this residue comes from mutation studies with the &2-adrenoceptor (Horstman et al, 1990) and the dopamine D2-receptor , in which substitution of the aspartate with asparagine (M2-receptor) or alanine (D2-receptor) abolished the regulatory action of Na' on ligand binding. With the histamine HI-receptor the regulation of agonist binding by Na' (Chang & Snyder, 1980) presumably involves in the second transmembrane loop of the HI-receptor cloned from bovine adrenal medulla (Yamashita et al, 1991) or Asp-73 in the rat HI-receptor (Fujimoto et al, 1993). How-ever, antagonist binding can also be modulated by Na+, as originally demonstrated for opiate receptors (Pert & Snyder, 1974;Paterson et al, 1986), and we have reported that Na+ ions distinguish between the binding of two antagonist radioligands to the histamine HI-receptor (Treherne et al, 1991).…”